Pooling TruSeq (single index) and Nextera XT (dual index) in one MiSeq run?

Carosmile · 05-08-2017, 05:32 AM

Hi everyone,

It is my first time posting on this forum. I was wondering if someone has mixed libraries prepared using Nextera XT and TruSeq LT in a single pair-end MiSeq run. Although Illumina's official answer is that they do not recommend it, tech support says that other people are doing it successfully.

This is my first time doing it and I have a couple of questions:

- I have been looking at the Nextera tagmetation reads/adapters and comparing them to the Illumina TruSeq reads. Do both sets of primers come in the reagent cartridge? I don't see how they can be sequenced with the same primers.... am I missing something?

According to Illumina the sequence of the adapters is

Nextera Transposase Adapters

Read 1
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Read 2
5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Nextera Index Kit – PCR Primers
Index 1 Read
5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Index 2 Read
5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

The TruSeq adapter/spacer sequences are

Universal Adapter
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

TruSeq Adapter, Index 1
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

- From the setup, I understand that the Nextera i7 barcodes are sequenced at the same time than the Truseq 6-base barcodes. Are there any incompatibility issues with the i7 indexes and the Truseq indexes that will prevent me from demultiplexing correctly when I get my sequences back? How many base pairs have to be different in order for us to differentiate the reads from one another?

- The libraries prepared with Nextera have a wider range of fragments (a wider area under the curve as per bioanalyzer) as well as a smaller average insert size than the libraries prepared with the TruSeq kit. I understand that there is a bias towards smaller fragments binding to the flow cell that will be reflected on the coverage per library. Is there a way to correct for that before pooling?

Thanks you all so much for your help!

Carolina

pmiguel · 05-16-2017, 02:13 PM

We do this and it works fine.

Details available in this thread.

--
Phillip

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
MiSeq Pooling\multiplexing 240 samples using Nextera v2 Index	elximo	Illumina/Solexa	10	10-18-2017 08:38 AM
How to mix single index and dual index TruSeq libraries	pmiguel	Illumina/Solexa	31	05-24-2017 04:10 AM
Dual-index vs single index	Ingeneious	Illumina/Solexa	4	01-19-2015 12:22 PM
Mixing dual and single index TruSeq samples in a single MiSeq run	pmiguel	Illumina/Solexa	1	12-21-2012 06:21 AM
New dual index Nextera TruSeq adapter sequences?	koadman	Illumina/Solexa	3	08-29-2012 06:17 PM

05-08-2017, 05:32 AM	#1
Carosmile Junior Member Location: TX Join Date: May 2017 Posts: 1	Pooling TruSeq (single index) and Nextera XT (dual index) in one MiSeq run? Hi everyone, It is my first time posting on this forum. I was wondering if someone has mixed libraries prepared using Nextera XT and TruSeq LT in a single pair-end MiSeq run. Although Illumina's official answer is that they do not recommend it, tech support says that other people are doing it successfully. This is my first time doing it and I have a couple of questions: - I have been looking at the Nextera tagmetation reads/adapters and comparing them to the Illumina TruSeq reads. Do both sets of primers come in the reagent cartridge? I don't see how they can be sequenced with the same primers.... am I missing something? According to Illumina the sequence of the adapters is Nextera Transposase Adapters Read 1 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Read 2 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG Nextera Index Kit – PCR Primers Index 1 Read 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index 2 Read 5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC The TruSeq adapter/spacer sequences are Universal Adapter 5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TruSeq Adapter, Index 1 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG - From the setup, I understand that the Nextera i7 barcodes are sequenced at the same time than the Truseq 6-base barcodes. Are there any incompatibility issues with the i7 indexes and the Truseq indexes that will prevent me from demultiplexing correctly when I get my sequences back? How many base pairs have to be different in order for us to differentiate the reads from one another? - The libraries prepared with Nextera have a wider range of fragments (a wider area under the curve as per bioanalyzer) as well as a smaller average insert size than the libraries prepared with the TruSeq kit. I understand that there is a bias towards smaller fragments binding to the flow cell that will be reflected on the coverage per library. Is there a way to correct for that before pooling? Thanks you all so much for your help! Carolina

05-16-2017, 02:13 PM	#2
pmiguel Senior Member Location: Purdue University, West Lafayette, Indiana Join Date: Aug 2008 Posts: 2,317	We do this and it works fine. Details available in this thread. -- Phillip