SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
FastQC analyses of trimmed MiSeq reads kmer content akjones Bioinformatics 4 02-07-2014 06:50 AM
FastQC,kmer content, per base sequence content: is this good enough mgg Bioinformatics 10 11-06-2013 10:45 PM
FastQC: 3' bias (weird peaks) in Kmer content graphics Ann7 RNA Sequencing 2 06-19-2013 05:31 AM
weird kmer-content peak in RNA-seq data kareldegendt Bioinformatics 2 08-22-2012 03:45 PM
kmer content in the first bases of Illumina sequence brachysclereid Bioinformatics 2 01-09-2012 02:54 PM

Reply
 
Thread Tools
Old 07-21-2014, 04:04 PM   #1
gab0
Member
 
Location: Talca, Chile

Join Date: Apr 2014
Posts: 11
Default weird kmer content in illumina PE reads

Hello

My name is Gabriel. I'm writing here because I'm analyzing Illumina reads (generated in a Hiseq 2000) from a genome of a particular insect species. So far, I've managed to remove the adapter sequence (including the indexed adapter), but when checking my filtered FastQ files with the latest FastQC version (V 0.11.2) I am seeing a weird kmer pattern in the 5' region, it seems that a particular sequence is over represented, but the overrepresented sequence module does not show anything weird.

Also, the Kmer content overrepresented has a strong bias towards GC (i.e GGCCCGG, GCCCGGG and so on). I've also managed to overlap the Kmers to this sequence GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGC but so far I've not been able to find anything related to this particular sequence. I'm concerned wheter it is OK to just trim this sequence, as I don't know how which meaning has this particular pattern.

So far and during my web search, I've only seen similar patterns when analyzing RNA-seq data, but this is not the case. Also, the "bad sequence" example from FastQC webpage shows a similar pattern, but in the 3' end, not in the 5' region, as this is my scenario.

It is worth noting that I have Paired end (2x100) files, and both files (1 and 2) have the same pattern.

I have attached the Kmer module graphs, I can add more information if needed.

Thank you very much, (and sorry for my english :P)

Gabriel
Attached Images
File Type: png index1.png (65.8 KB, 152 views)
File Type: png index-reverse.png (66.0 KB, 98 views)
gab0 is offline   Reply With Quote
Old 09-25-2017, 05:04 AM   #2
svitlana
Member
 
Location: Brussels

Join Date: Jun 2017
Posts: 15
Default

Hello gab0!

I am facing the same problem as you and I would like to know whether you found out where the sequence GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGC comes from?

Thank you!
svitlana is offline   Reply With Quote
Old 09-25-2017, 11:41 AM   #3
jdk787
josh kinman
 
Location: Austin

Join Date: Apr 2014
Posts: 64
Default

Hello Svitlana
I looked at this sequence from your other post http://seqanswers.com/forums/showthread.php?t=78247 and the reverse complement matches TruSeq Process controls CTA-150bp, CTA-450bp, CTA-550bp, and CTA-850bp.
__________________
Josh Kinman
jdk787 is offline   Reply With Quote
Old 09-26-2017, 02:22 AM   #4
svitlana
Member
 
Location: Brussels

Join Date: Jun 2017
Posts: 15
Default

Quote:
Originally Posted by jdk787 View Post
Hello Svitlana
I looked at this sequence from your other post http://seqanswers.com/forums/showthread.php?t=78247 and the reverse complement matches TruSeq Process controls CTA-150bp, CTA-450bp, CTA-550bp, and CTA-850bp.
You are right jdk787, sorry I didn't see your first response. Thank you again!
svitlana is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:12 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO