
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
What tools can convert sequence file from tabular format to fasta format? yangjianhunt Bioinformatics 5 03-26-2014 01:48 PM
Convert maf (multiple alignment file) to FASTA Avro1986 Bioinformatics 4 12-17-2012 11:12 AM
Convert WIG file into Fasta file kumardeep Bioinformatics 3 08-23-2012 04:56 AM
Text file editing_perl-GFF bioman1 Bioinformatics 0 07-05-2012 08:47 AM
How to convert diploid abi file into two fasta sequences? ymc Bioinformatics 1 04-28-2011 06:24 PM

Thread Tools
Old 03-28-2013, 09:53 AM   #1
Giorgio C
Location: ITALY

Join Date: Oct 2010
Posts: 89
Default convert a text file in fasta with decollpasing

Hi all,

I have this file:


They are sequences and the numbers are the respective occurrences. I would like to convert that file in a fasta format, decollapsing the sequences and giving a name like that:

for 424866 times.

TAGCTTATCAGACTGATGTTGA (the second sequences)

The same for the other sequences in series. Is there any scripts for that purpose?

Thanks in advance,
Giorgio C is offline   Reply With Quote
Old 03-28-2013, 12:07 PM   #2
PhD Student
Location: Denmark

Join Date: Jul 2012
Posts: 164

awk '{for(i=0;i<=($2-1);i++) print ">Sample"NR"_"i"\n"$1}' file.txt
This might work!
vivek_ is offline   Reply With Quote
Old 03-28-2013, 12:49 PM   #3
Giorgio C
Location: ITALY

Join Date: Oct 2010
Posts: 89

Thanks vivek it works great!
Giorgio C is offline   Reply With Quote
Old 03-29-2013, 10:48 AM   #4
Senior Member
Location: Denmark

Join Date: Apr 2009
Posts: 153

This can also be done with Biopieces (

read_tab -i -k SEQ,COUNT | duplicate_record -k COUNT | add_ident -k SEQ_NAME -p Sample1_ | write_fasta -x
maasha is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 05:18 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO