
Go Back   SEQanswers > Applications Forums > RNA Sequencing

Similar Threads
Thread Thread Starter Forum Replies Last Post
Paired-end Bam from single-end aligned sam ramouz87 Bioinformatics 4 08-17-2011 12:55 PM
How to infer Illumina paired-end strand specificity from SAM output? David Harmin Bioinformatics 0 02-16-2011 08:34 AM
Paired end inconsistency in tophat SAM dariober Bioinformatics 2 11-06-2010 06:59 AM
TopHat SAM - Expressing Paired End Multi-reads Bio.X2Y Bioinformatics 2 05-28-2010 08:07 AM
How to find structure variations from paired end sequencing in SAM format jfshao1984 Bioinformatics 0 08-21-2009 05:38 AM

Thread Tools
Old 04-21-2011, 10:55 PM   #1
Location: Taiwan

Join Date: Jan 2010
Posts: 17
Default SAM file for paired-end

I've aligned the Solexa data with tophat.
After doing the alignment, I got the bam file.
Since I want to find some fusion junction, which contains two different genes in one read, I have to search from the bam file.
I first transform the bam to sam.
Part of the sam file would be as follows:
HWUSI-EAS1812:1:100:10011:5732#0 147 chr6 63921573 3 76M = 63921570 0 GATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAG ghhghhghghhhhgfhhhhhhhghgghhhhhhhhchhffhahhhhhhhhhhhhhhghhhgfhhhhhfhhhhhhhhh NM:i:0 NH:i:2
HWUSI-EAS1812:1:100:10011:5732#0 163 chr20 1356146 3 76M = 1356149 0 CTTCTTCCCAGCCTCGGATCACCTCCTGCTTGCCTAGCATAAACTTAAAGGGCTTGTTTCTGTCCCGGGAGGAATC hhhhhhhhhfhhhhhfghhhghhhhhhhhhhhhhhahffhhchhhhhhhhgghghhhhhhhfghhhhghghhghhg NM:i:0 NH:i:2 CC:Z:chr6 CP:i:63921573
HWUSI-EAS1812:1:100:10011:5732#0 83 chr20 1356149 3 76M = 1356146 0 CTTCCCAGCCTCGGATCACCTCCTGCTTGCCTAGCATAAACTTAAAGGGCTTGTTTCTGTCCCGGGAGGAATCAAA gefhhhhhhhhhhhhhhdghhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh NM:i:0 NH:i:2 CC:Z:chr6 CP:i:63921570
HWUSI-EAS1812:1:100:10011:5732#0 99 chr6 63921570 3 76M = 63921573 0 TTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAG hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhghhhhhhhhhhhhhhhhhhhhgdhhhhhhhhhhhhhhfeg NM:i:0 NH:i:2

Well, I just want to find the paired-end two reads pair, and I want to analyze the CIGAR term.
I'm not sure why the Read name(HWUSI-EAS1812:1:100:10011:5732#0) include so many different positions.
It's quite weird.

Could anybody explain their meanings?
Thanks a lot.
ECHo is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 12:33 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO