SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
BWA 0.6.1 fail to insert infer isize: weird pairing + Segmentation Fault attilav Bioinformatics 5 02-20-2012 02:54 PM
Weird Illumina library ashchin Illumina/Solexa 7 02-17-2012 11:34 AM
Weird library with ScriptSeq cascoamarillo Sample Prep / Library Generation 3 01-24-2012 06:58 AM
de novo sequencing of maize (lane and insert size library) sflong Illumina/Solexa 2 10-31-2011 08:30 AM
Library insert size of Phix? Dr. Hybe Illumina/Solexa 2 01-24-2011 11:18 AM

Reply
 
Thread Tools
Old 11-18-2011, 09:14 AM   #1
skblazer
Member
 
Location: Massachusetts

Join Date: Feb 2009
Posts: 50
Default The weird insert sequence dominated my library

Hi,

I constructed an Illumina paired-end library for test, and TOPO cloned an aliquot of the library. I just received six sequence of the picked clones, all of them are adaptered fragments with correct insert size. BUT, only one of the insert fragment are from the genome of my organism. I try to find where are the others from, but I can't find any significant hits using NCBI blastn against nt database. They don't look like dimer, as they are not identical to each other.

Is there anyone have similar experience with this? I know they might be contamination, but I don't know what types of contamination are they, and why they dominate my library?

Last edited by skblazer; 11-18-2011 at 09:19 AM.
skblazer is offline   Reply With Quote
Old 11-18-2011, 10:13 AM   #2
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

Try a blastx against nr.

What type of PE library did you make? TruSeq? Something else?

If you wanted to post the sequences here, we might find something.

--
Phillip
pmiguel is offline   Reply With Quote
Old 11-18-2011, 10:46 AM   #3
skblazer
Member
 
Location: Massachusetts

Join Date: Feb 2009
Posts: 50
Default

Thanks Phillip,

It's just a regular genomic paired-end library, with PE1.0 and PE2.0 as adapters (underlined). I tried blastx, but none of them have significant hits.

I posted three sequence here, thanks for the help:

CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTAATACACTTCTTCCCGCACATCTCGCAGACGTGACTGTCGGCCGGTTTCTTGTAACAGCGCGGCTTGTTCTGTTTCATCTTAAGTCCGAGGTGTACTCTCTGGTAGTGGATCGTGTAGGAACTAGATGACGAAAACGTTAGTTTGCACTGAAAGAATATAAAGTTGATGTATATAATGTGAGAGTAGGCAAACGAGCAGACGGCCTACTTGGTGGTCAGTAGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGACCGTCGATCAGATGCAAAATTTCCTCCTCGTCCAGGTGATGTTCGATATTGTCGGGATTCAGTATGGGTATAGATATGCCCATGTTGTCCAATTTGTCAAGAATCTATTTGGACGCCTTCTTAAATAGTATTTTACCCAAACTAATTATCATGCCTTTCATTTTGATGGAGGACGAGGCGCTGTACAACGCCTTCATTTCCTCCTCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG

CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTGTTGTCCTTCAATTCGCGCAGACGTTTCACGTTCAGGGCGCTTTGGATTTTTTGGGATTGCGTGAGAATACACATGTGTATGCCGAACGGCAGCCTGTCGATGGACATGAAGAACGGATTTCTGGTGTTTATTAACATCCACAACAATCGTTTGACGTGATCGTCACCGCTGCGAATGGCATTTTCGATGGTGGTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

Quote:
Originally Posted by pmiguel View Post
Try a blastx against nr.

What type of PE library did you make? TruSeq? Something else?

If you wanted to post the sequences here, we might find something.

--
Phillip
skblazer is offline   Reply With Quote
Old 11-18-2011, 11:29 AM   #4
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

Got a couple of hits to the first one in dbest:

Code:
>gb|EY266324.1|  BF01045B2A10.f1 Normalized subtracted keck library BF01 Danaus 
plexippus cDNA clone BF01045B2A10.f1 5, mRNA sequence.
Length=792

 Score =  269 bits (298),  Expect = 3e-69
 Identities = 149/149 (100%), Gaps = 0/149 (0%)
 Strand=Plus/Minus

Query  1    AATACACTTCTTCCCGCACATCTCGCAGACGTGACTGTCGGCCGGTTTCTTGTAACAGCG  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  671  AATACACTTCTTCCCGCACATCTCGCAGACGTGACTGTCGGCCGGTTTCTTGTAACAGCG  612

Query  61   CGGCTTGTTCTGTTTCATCTTAAGTCCGAGGTGTACTCTCTGGTAGTGGATCGTGTAGGA  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  611  CGGCTTGTTCTGTTTCATCTTAAGTCCGAGGTGTACTCTCTGGTAGTGGATCGTGTAGGA  552

Query  121  ACTAGATGACGAAAACGTTAGTTTGCACT  149
            |||||||||||||||||||||||||||||
Sbjct  551  ACTAGATGACGAAAACGTTAGTTTGCACT  523


>gb|EY270604.1|  BF01052B2H04.f1 Normalized subtracted keck library BF01 Danaus 
plexippus cDNA clone BF01052B2H04.f1 5, mRNA sequence.
Length=668

 Score = 64.4 bits (70),  Expect = 2e-07
 Identities = 55/68 (81%), Gaps = 0/68 (0%)
 Strand=Plus/Plus

Query  155  AATATAAAGTTGATGTATATAATGTGAGAGTAGGCAAACGAGCAGACGGCCTACTTGGTG  214
            |||||| | ||  ||| | | |||| | ||  ||||||||||||||||||||||||||||
Sbjct  144  AATATATATTTATTGTTTTTTATGTTAAAGGTGGCAAACGAGCAGACGGCCTACTTGGTG  203

Query  215  GTCAGTAG  222
            | ||| ||
Sbjct  204  GGCAGCAG  211
If your organism is a butterfly, then I would guess your library may be fine. Just from an organism without its genome in nt.

--
Phillip
pmiguel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:20 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO