SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
trim adapter from Illumina Genome Analyzer IIe miRNA reads NicoBxl Bioinformatics 5 01-02-2014 06:31 AM
Illumina Adapter and Primer preparation S.Iyengar Sample Prep / Library Generation 7 11-04-2013 08:08 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 02:36 PM
what's the different between Illumina Genome Analyzer biocc Illumina/Solexa 3 06-04-2010 12:28 AM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences kaichen Illumina/Solexa 1 08-06-2009 06:57 PM

Reply
 
Thread Tools
Old 09-16-2009, 12:58 PM   #41
haheller
Junior Member
 
Location: WI

Join Date: Sep 2009
Posts: 2
Default

New to this so my knowledge-base is still quite limited so be gentle in reply, please
We will prepare miRNA-Seq library and send it out for sequencing on a GAII. Can anyone confirm that these adapter/Primer sequences first reported by ECO have (can) been used successfully on the GAII (and presumably GAIIx)?

Small RNA oligonucleotide sequences
RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

Was (is) there a GAI instrument? Does it require different Adapter/Primer sequences? Can't find any evidence of a GAI version on Illumina website.
Thanks in advance
haheller is offline   Reply With Quote
Old 01-13-2010, 02:23 PM   #42
Samodha
Junior Member
 
Location: Cambridge

Join Date: Jan 2010
Posts: 1
Default

Hi,
I am New to Illumina sequencing. This is a great resource!!! I was wondering if anyone has figured out the sequences of the multiplexing adaptors.

Thanks
Samodha is offline   Reply With Quote
Old 02-04-2010, 09:13 AM   #43
bp79
Junior Member
 
Location: UK

Join Date: Feb 2010
Posts: 1
Default

Thanks for all the helpful stuff on here. A quick newbie question: are all these adapter sequences etc definitely unchanged across the various incarnations of Illumina (GAI, IIe, IIx) - I think so but not certain?
Thanks
bp
bp79 is offline   Reply With Quote
Old 02-04-2010, 11:23 AM   #44
der_eiskern
Member
 
Location: California

Join Date: Jul 2009
Posts: 46
Default

i can say the SE adaptors worked on my GAIIx SE sequencing runs last August with the latest kits at the time.

Last edited by der_eiskern; 02-04-2010 at 11:25 AM. Reason: clarification
der_eiskern is offline   Reply With Quote
Old 02-04-2010, 09:54 PM   #45
hheuven
Junior Member
 
Location: Utrecht

Join Date: Feb 2010
Posts: 1
Default merging MAQ map files exceed limits

Dear all,

I have 45M (25M in pairs) aligned Solexa reads of 62 bp length in several map files after running Maq map. I have removed the duplicates and now I want to merge them, but get an error message that says that the size of the merged file becomes to big (> 2.1G). How I can get around this?

Are there scripts available that allow me to split the mapfiles according to chromosome number?


Kind regards
Henri Heuven
vet.fac.uu
hheuven is offline   Reply With Quote
Old 03-24-2010, 04:31 AM   #46
cur
Junior Member
 
Location: aberdeen

Join Date: Dec 2009
Posts: 5
Default solexa adapter sequences for paired end data

Hi
I wonder if somebody can help me here....I have got some solexa data (paired end reads) and want to map these to the genome with bwa/maq...However when I did this only 20% of sequences mapped so I gather I want to check/ for presence of adapters in the sequences and then repeat the alignment after trimming of the data.

Which adapter sequences should I screen for- as this is paired end data I assume its the 5` to 3` sequence for the PE adpter 1 and 2 which I found in one of your posts?
Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'

In fasta format:
>Solexa-PairedEndAdapter1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>SolexaPairedEndAdapter2
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

If I had single end solexa data would I then screen for the same adapters

Genomic DNA oligonucleotide sequences (from previous posting)
Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Last edited by cur; 03-24-2010 at 04:39 AM.
cur is offline   Reply With Quote
Old 03-24-2010, 07:42 AM   #47
greigite
Senior Member
 
Location: Cambridge, MA

Join Date: Mar 2009
Posts: 141
Default

Hi cur,

That is not quite right- you have to use the sequence of the PCR product produced by amplification of your library with paired end primers to identify sequences to screen out. You are looking for sequence between your insert and the flow cell oligo. This would appear in your product only if your insert was incredibly short (or nonexistent)- I suspect you may have sequenced a whole bunch of adapters. What did your Bioanalyzer trace look like? I've found that the molar ratio of amplified adapter sequence (~130 bp) to amplified library is pretty close to the percentage of adapter only reads you get.

I believe the following is right but others please correct if not:

Sequence between your insert and the flow cell oligo for Round 1 paired end:
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG

Sequence between your insert and the flow cell oligo for Round 2 paired end:
AGAAAGGGATGTGCTGCGAGAAGGCTAGA

For single read the appropriate sequence to screen out depends whether you prepped your libraries with single or paired end adapters.
greigite is offline   Reply With Quote
Old 04-07-2010, 03:51 PM   #48
jsilhavy
Junior Member
 
Location: San Diego

Join Date: Apr 2010
Posts: 1
Default Illumina Index PE adaptor

Hi,

I purchased Illumina's multiplexing kit and ligated the index PE adaptor to my samples. However, I soon learned that this kit is not compatible with Agilent's SureSelect DNA Capture protocol (microarray based). I would still like to proceed with the library prep (have not added the barcodes/indexes) but was wondering if anyone knew the difference between Illumina's Index PE adaptor and standard PE adaptors.

Thanks!!
jsilhavy is offline   Reply With Quote
Old 04-20-2010, 12:43 PM   #49
clpX
Junior Member
 
Location: Oslo, Norway

Join Date: Apr 2010
Posts: 2
Default Re: Illumina Index PE adaptor

Hi jsilhavy,

the adapters are quite similar because the index is added in the PCR step and does not come with the adapters. I attach a file with the sequences that I found in some other post in this forum.
Attached Files
File Type: pdf Illumina Sequence Information for Customers DEC2008.pdf (77.2 KB, 1121 views)
clpX is offline   Reply With Quote
Old 04-21-2010, 01:22 AM   #50
cur
Junior Member
 
Location: aberdeen

Join Date: Dec 2009
Posts: 5
Default

Hi greigite
Thanks for the reply- in this case the answer was actually simple in the end- the sequencing service had not sent us the right data. Once we got the right data there was no problem with the alignment :-) what a relief
cur is offline   Reply With Quote
Old 04-23-2010, 08:28 AM   #51
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

Does anyone know the primer concentrations required for SE ChIP library preparation?

This is the information given in the protocol:
Quote:
Prepare the following PCR reaction mix:
• DNA (36 μl)
• 5x Phusion* buffer (10 μl)
• dNTP mix (1.5 μl)
• PCR primer 1.1 (1 μl)
• PCR primer 2.1 (1 μl)
• Phusion* polymerase (0.5 μl)
The total volume should be 50 μl.
N.b. only 10 ng of DNA is used for the library preparation in the first place, so the primer concentrations might be lower than for whole genome DNA sequencing?

Thanks.

Last edited by AdamB; 04-23-2010 at 08:31 AM.
AdamB is offline   Reply With Quote
Old 04-26-2010, 03:00 AM   #52
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

I found the answer in another thread. Just to check, I called Illumina tech support, and they have confirmed the stock PCR primer 1.1 and 2.1 concentration is 25 uM.
AdamB is offline   Reply With Quote
Old 04-27-2010, 04:26 AM   #53
jchoo
Junior Member
 
Location: harbin,china

Join Date: Mar 2010
Posts: 9
Default

thanks,thats what i want,by the way weather all the illumina use the same adapter?
jchoo is offline   Reply With Quote
Old 05-05-2010, 12:56 PM   #54
kr067
Junior Member
 
Location: us

Join Date: May 2010
Posts: 5
Default paired end seq

Hi all,
Im new to paired end mRNA seq. Are the adapters for the paired end seq same as the genomic DNA adapters?
Thanks
kr067 is offline   Reply With Quote
Old 05-05-2010, 04:53 PM   #55
sci_guy
Member
 
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83
Default

@kr067: No. Read the pdf posted by clpX above.
sci_guy is offline   Reply With Quote
Old 05-06-2010, 07:22 AM   #56
kr067
Junior Member
 
Location: us

Join Date: May 2010
Posts: 5
Default

Thank you sci_guy! that was really helpful!
kr067 is offline   Reply With Quote
Old 05-12-2010, 02:09 PM   #57
amango
Member
 
Location: New York

Join Date: Dec 2009
Posts: 17
Default

I noticed that several people were wondering about adaptor and primer concentrations in the Illumina kit. I just spoke to an Illumina tech support person, and for RNA-seq at least, the working concentration for the adaptor oligo mix is 15 uM while PCR primers are 25 uM.
amango is offline   Reply With Quote
Old 05-18-2010, 05:35 AM   #58
mx1970
Junior Member
 
Location: Spain

Join Date: Sep 2009
Posts: 3
Default

Hi,
I want to do directional mRNA seq. I have to use the Small RNA Sequencing Primer during the primer hybridization.
Does anybody know at which concentration should I adjust this primer?
thanks
mx1970 is offline   Reply With Quote
Old 05-24-2010, 04:05 AM   #59
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

I ordered the following primers from Sigma:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T

(HPLC-purified)
*=Phosphorothioate bond

However I can't get them working with my ChIP input DNA sample. Have tried varying the number of cycles, but each time after the PCR amplification of my library I only have 2 or 3 ng/ul, whereas colleagues have had more like 20 ng/ul.

I'm unsure whether the problem is with the primers or something else. As far as I know, everything apart from the primers is the same as colleagues' libraries that worked. I don't have any Illumina primer to test alongside.
AdamB is offline   Reply With Quote
Old 05-31-2010, 09:26 AM   #60
[email protected]
Junior Member
 
Location: Co Kildare Ireland

Join Date: May 2010
Posts: 1
Default PE indexed libraries

I'm trying to figure out what the final sequence of an Illumina PE indexed library is and where the enrichment primers and sequencing primers go. Has anyone figured out a schematic of generation of the PE indexed libraries showing all the sequence similar to the one I found on this forum for non-indexed PE libraries (see below).

dandestroy09-18-2008, 07:13 PM
Sorry for the small font, but that's the only way I could make it fit




PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCGGTTCAG CAGGAATGCCGAGACCGATC TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'
matthew.mccabe@teagasc.ie is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:06 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO