Remove adapter sequence

vini · 04-11-2011, 09:42 AM

Hi,

I am a newbie in the field of RNA-Seq and i apologize if this query seems too trivial. I have Solid data in fasta format and i am supposed to remove the P2 adapter.

The P2 adapter sequence is:
5' ------- (-) AGAGAATGAGGAACCCGGGG CAGTT--- - 3'
3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5'

Does this mean that the
5' ------(-) AGAGAATGAGGAACCCGGGG CAGTT--- -3' will be present at the 3'end of the reads while the
3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5' would be present at the 5'end of the read?

Thanks,
vini

KevinLam · 04-13-2011, 09:28 AM

When you say fasta format did you mean you converted the solid raw data from csfasta to fasta?

That's generally not advised as it may introduce errors into your reads if there's an upstream miscall on the cs base.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
how to remove 3'-adaptor sequence from illumina DGE expression data	archory	Bioinformatics	6	12-05-2011 06:55 AM
how to remove 3'-adaptor sequence from illumina DGE expression data	archory	Illumina/Solexa	0	11-29-2011 05:53 PM
illumina smallRNA adapter sequence for downstram analysis + miRNA analysis steps	ndeshpan	Bioinformatics	2	06-14-2011 09:44 PM
trim 3' adapter sequence for mRNA-Seq?	slny	Bioinformatics	14	06-14-2011 06:15 AM
Adapter sequence	minky81	General	2	04-02-2010 08:53 AM

04-11-2011, 09:42 AM	#1
vini Junior Member Location: US Join Date: Mar 2011 Posts: 2	Remove adapter sequence Hi, I am a newbie in the field of RNA-Seq and i apologize if this query seems too trivial. I have Solid data in fasta format and i am supposed to remove the P2 adapter. The P2 adapter sequence is: 5' ------- (-) AGAGAATGAGGAACCCGGGG CAGTT--- - 3' 3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5' Does this mean that the 5' ------(-) AGAGAATGAGGAACCCGGGG CAGTT--- -3' will be present at the 3'end of the reads while the 3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5' would be present at the 5'end of the read? Thanks, vini

04-13-2011, 09:28 AM	#2
KevinLam Senior Member Location: SEA Join Date: Nov 2009 Posts: 188	When you say fasta format did you mean you converted the solid raw data from csfasta to fasta? That's generally not advised as it may introduce errors into your reads if there's an upstream miscall on the cs base. __________________ http://kevin-gattaca.blogspot.com/