
Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD

Similar Threads
Thread Thread Starter Forum Replies Last Post
how to remove 3'-adaptor sequence from illumina DGE expression data archory Bioinformatics 6 12-05-2011 07:55 AM
how to remove 3'-adaptor sequence from illumina DGE expression data archory Illumina/Solexa 0 11-29-2011 06:53 PM
illumina smallRNA adapter sequence for downstram analysis + miRNA analysis steps ndeshpan Bioinformatics 2 06-14-2011 10:44 PM
trim 3' adapter sequence for mRNA-Seq? slny Bioinformatics 14 06-14-2011 07:15 AM
Adapter sequence minky81 General 2 04-02-2010 09:53 AM

Thread Tools
Old 04-11-2011, 10:42 AM   #1
Junior Member
Location: US

Join Date: Mar 2011
Posts: 2
Post Remove adapter sequence


I am a newbie in the field of RNA-Seq and i apologize if this query seems too trivial. I have Solid data in fasta format and i am supposed to remove the P2 adapter.

The P2 adapter sequence is:
3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5'

Does this mean that the
5' ------(-) AGAGAATGAGGAACCCGGGG CAGTT--- -3' will be present at the 3'end of the reads while the
3' ------- (-) TCTCTTACTCCTTGGGCCCC GTC----- - 5' would be present at the 5'end of the read?

vini is offline   Reply With Quote
Old 04-13-2011, 10:28 AM   #2
Senior Member
Location: SEA

Join Date: Nov 2009
Posts: 196

When you say fasta format did you mean you converted the solid raw data from csfasta to fasta?

That's generally not advised as it may introduce errors into your reads if there's an upstream miscall on the cs base.
KevinLam is offline   Reply With Quote

solid p2 adapter

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 09:58 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2016, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO