![]() |
|
|||||||
Similar Threads
|
||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Bowtie call to get unique, multi-hits and nonmatching reads | PFS | Bioinformatics | 2 | 07-19-2011 01:05 PM |
| how to extract unique hits from a sam file | gfmgfm | Bioinformatics | 4 | 01-23-2011 09:48 PM |
| Regarding Unique reads, Unique alignments | sridharacharya | RNA Sequencing | 2 | 09-20-2010 05:39 AM |
| Unique VS Non-Unique read analysis | samt | Bioinformatics | 2 | 09-29-2009 09:44 AM |
| Unique and repeat Hits | pfranchini | Bioinformatics | 1 | 07-15-2009 08:51 AM |
![]() |
|
|
Thread Tools |
|
|
#1 |
|
Member
Location: ma Join Date: Mar 2011
Posts: 45
|
Hi there,
I am looking for a way to find unique hits for my RNA-seq data. After searching online and in this community, I still can't find a good way to find unique hits from a sam file. Any input will be welcome. I used tophat to align the data to the HG19 and samtools -bq -1 to generated reliable hits. Here is part of the output: [Tophat_out]$ grep -w SRR087416.97659 accepted_hits_realiable.sam SRR087416.97659 0 chr1 11356 1 36M * 0 0 CAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGT BBBCBCB9CBBBC@:+>3A97AACABA9@CCCCB9# NM:i:0 NH:i:4 CC:Z:chr12 CP:i:94218 SRR087416.97659 16 chr12 94218 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr15 CP:i:102519779 SRR087416.97659 16 chr15 102519779 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr2 CP:i:114359624 My questions are: Does this mean that the read SRR087416.97659 maps to chr1, chr12, and chr15? If I understand the concept "unique-hit" correctly, then this read can not be counted as an unique hit. Am I right? Thanks, -A |
|
|
|
|
|
#2 | |
|
Member
Location: Massachusetts Join Date: May 2011
Posts: 24
|
Quote:
|
|
|
|
|
|
|
#3 |
|
Member
Location: Massachusetts Join Date: May 2011
Posts: 24
|
btw, what instrumentation this output is coming from? Thanks.
|
|
|
|
|
|
#4 |
|
Member
Location: ma Join Date: Mar 2011
Posts: 45
|
Thanks for your message.
The result is generated by a Mac Pro with 8GB Memory and 1TB hard drive. Is that you want to know? |
|
|
|
|
|
#5 |
|
Member
Location: Massachusetts Join Date: May 2011
Posts: 24
|
my questions was what DNA sequencing platform this output is from, such as Illumina, ABI SOLiD, etc. thanks.
|
|
|
|
|
|
#6 |
|
Member
Location: ma Join Date: Mar 2011
Posts: 45
|
Oh. Sorry.
This is Illumina RNA sequencing data. |
|
|
|
|
|
#7 |
|
Member
Location: ma Join Date: Mar 2011
Posts: 45
|
Does anybody knows that the value 0 in "SRR087416.97659 0" means? I checked samtools menu, it only says if 0x1 is unset, no assumptions can be made about .....
|
|
|
|
|
|
#8 | |
|
Member
Location: ma Join Date: Mar 2011
Posts: 45
|
I found an old post saying that
Quote:
Last edited by arrchi; 06-01-2011 at 07:55 AM. |
|
|
|
|
![]() |
| Thread Tools | |
|
|