SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Splice site mutation Tiaret Bioinformatics 1 06-08-2011 01:14 AM
PubMed: Enhanced mismatch mutation analysis: simultaneous detection of point mutation Newsbot! Literature Watch 0 12-14-2010 02:20 AM
how to define nonsense mutation yuanzhi Bioinformatics 16 12-01-2010 10:28 AM
Mutation discovery wrapapu Genomic Resequencing 1 03-24-2010 01:19 AM
Bowtie warning: skip solexa** because it is less than 4 characters. pythonlovesbowtie Bioinformatics 0 11-17-2009 11:11 PM

Reply
 
Thread Tools
Old 07-06-2011, 05:41 AM   #1
lindenb
Junior Member
 
Location: France

Join Date: Apr 2010
Posts: 8
Default Why does mpileup skip my mutation ?

(cross posted on biostar: http://biostar.stackexchange.com/questions/9961 )

Hi all,

I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.

Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.

Code:
       120458491 120458501
CCTGCTCTGGGGAGCTATGCCAGGATGGGTGCC
........R........................
.....C..A..................C.....
........C. ......................
............  ...................
........A.....    ...............
,,,,,,,,a,,,,,,,,,,,,,,,,  ......
,,,,,,,,a,,,,,,,,,,,,,,,,,,,    .
........A........................
........A........................
.............................C...
........A........................
.................................
........A........................
.................................
.................................
........A........................
......................C..........
........A........................
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
........A........................
.................................
 ................................
  ...............................
   .....A........................
      ,,,,,,,,,gg,,,,,,,,,,,t,,,,
       .A........................
        .........................
however, we I call the mutations using samtools mpileup

Code:
${SAMTOOLS}/samtools mpileup -uf  ${HG19} sample.bam |\
  ${SAMTOOLS}/bcftools/bcftools view  -bvcg - > snps.bcf
${SAMTOOLS}/bcftools/bcftools view  snps.bcf | gzip --best > snps.vcf.gz
But I can't see the mutation in the VCF.

here is the output of pileup (not mpileup):

Code:
(...)
chr1    120458492   G   26  C.AaaAA.A.A..A.A,A...A,AA^].    JddfhQacfhhgggahehhhhaB[hg
(...)
How can I know why mpileup (or bcftools ?) skipped this mutation ?

Thanks !

Pierre
lindenb is offline   Reply With Quote
Old 07-06-2011, 08:19 AM   #2
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 763
Default

Try redoing mpileup with -Buf. That's worked for me. Like you, I observed that my sanger-verified mutation looked fine in pileup, but when I looked at it in the mpileup run without -B, the Baq calculations destroyed the quality scores of that locus, so it wouldn't call a SNP. Running it with -B should make your mpileup look like your pileup at that locus, and then the SNP will have high enough quality to be counted.
swbarnes2 is offline   Reply With Quote
Old 07-06-2011, 10:59 PM   #3
lindenb
Junior Member
 
Location: France

Join Date: Apr 2010
Posts: 8
Default

That worked ! many thanks !
lindenb is offline   Reply With Quote
Old 07-07-2011, 05:54 AM   #4
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 609
Default

try -E
...
lh3 is offline   Reply With Quote
Reply

Tags
mpileup, pileup, samtools

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:34 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.