Why does mpileup skip my mutation ?

lindenb · 07-06-2011, 05:41 AM

(cross posted on biostar: http://biostar.stackexchange.com/questions/9961 )

Hi all,

I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.

Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.

Code:

       120458491 120458501
CCTGCTCTGGGGAGCTATGCCAGGATGGGTGCC
........R........................
.....C..A..................C.....
........C. ......................
............  ...................
........A.....    ...............
,,,,,,,,a,,,,,,,,,,,,,,,,  ......
,,,,,,,,a,,,,,,,,,,,,,,,,,,,    .
........A........................
........A........................
.............................C...
........A........................
.................................
........A........................
.................................
.................................
........A........................
......................C..........
........A........................
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
........A........................
.................................
 ................................
  ...............................
   .....A........................
      ,,,,,,,,,gg,,,,,,,,,,,t,,,,
       .A........................
        .........................

however, we I call the mutations using samtools mpileup

Code:

${SAMTOOLS}/samtools mpileup -uf  ${HG19} sample.bam |\
  ${SAMTOOLS}/bcftools/bcftools view  -bvcg - > snps.bcf
${SAMTOOLS}/bcftools/bcftools view  snps.bcf | gzip --best > snps.vcf.gz

But I can't see the mutation in the VCF.

here is the output of pileup (not mpileup):

Code:

(...)
chr1    120458492   G   26  C.AaaAA.A.A..A.A,A...A,AA^].    JddfhQacfhhgggahehhhhaB[hg
(...)

How can I know why mpileup (or bcftools ?) skipped this mutation ?

Thanks !

Pierre

swbarnes2 · 07-06-2011, 08:19 AM

Try redoing mpileup with -Buf. That's worked for me. Like you, I observed that my sanger-verified mutation looked fine in pileup, but when I looked at it in the mpileup run without -B, the Baq calculations destroyed the quality scores of that locus, so it wouldn't call a SNP. Running it with -B should make your mpileup look like your pileup at that locus, and then the SNP will have high enough quality to be counted.

lindenb · 07-06-2011, 10:59 PM

That worked ! many thanks !

lh3 · 07-07-2011, 05:54 AM

try -E
...

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Splice site mutation	Tiaret	Bioinformatics	1	06-08-2011 01:14 AM
PubMed: Enhanced mismatch mutation analysis: simultaneous detection of point mutation	Newsbot!	Literature Watch	0	12-14-2010 02:20 AM
how to define nonsense mutation	yuanzhi	Bioinformatics	16	12-01-2010 10:28 AM
Mutation discovery	wrapapu	Genomic Resequencing	1	03-24-2010 01:19 AM
Bowtie warning: skip solexa** because it is less than 4 characters.	pythonlovesbowtie	Bioinformatics	0	11-17-2009 11:11 PM

07-06-2011, 08:19 AM	#2
swbarnes2 Senior Member Location: San Diego Join Date: May 2008 Posts: 763	Try redoing mpileup with -Buf. That's worked for me. Like you, I observed that my sanger-verified mutation looked fine in pileup, but when I looked at it in the mpileup run without -B, the Baq calculations destroyed the quality scores of that locus, so it wouldn't call a SNP. Running it with -B should make your mpileup look like your pileup at that locus, and then the SNP will have high enough quality to be counted.

07-06-2011, 10:59 PM	#3
lindenb Junior Member Location: France Join Date: Apr 2010 Posts: 8	That worked ! many thanks !

07-07-2011, 05:54 AM	#4
lh3 Senior Member Location: Boston Join Date: Feb 2008 Posts: 609	try -E ...