BAM with inconsistent flag and mapq

[dariober]

Hi All,

I found two reads with sam flag 4 (unmapped) but with MAPQ 23 and with actual map positions.
Maybe I'm missing something trivial here... I aligned reads (27 bp) using BWA, converted sam to bam and I sorted the bam. (Unfortunately, I deleted the sam and unsorted bam.)

Here's the incriminated reads:

samtools view -f 4 -q 13 cage_12102010_lps.sorted.bam
HWUSI-EAS1501_0026_FC707N4AAXX:1:56:6629:10136#0	4	MT	16589	23	27M	*	0	0	GAAATTCTAACTAAATTATTCCCTGCA	G:====;12;77647&4228<DDD8B;	XT:A:U	NM:i:1	X0:i:1	X1:i:1	XM:i:1	XO:i:0	XG:i:0	MD:Z:25G1	XA:Z:15,+119268672,27M,2;
HWUSI-EAS1501_0026_FC707N4AAXX:1:94:8019:14641#0	4	MT	16589	23	27M	*	0	0	GAAATTCTAACTAAATTATTCCCTGCA	D0?BB?=DDD9C>?=);=A@==;3;;@	XT:A:U	NM:i:1	X0:i:1	X1:i:1	XM:i:1	XO:i:0	XG:i:0	MD:Z:25G1	XA:Z:15,+119268672,27M,2;

Versions:
bwa 0.5.9-r16
samtools 0.1.15

How can it be?
Any comment/explanation welcome
Many thanks
Dario

[swbarnes2]

A couple possibilities right off the bat.

First, if your reads are paired, the sam format calls for the unmapped mate of a mapped read to be given the same map position as the mapped read. This is so they will sort together. You have to look at the flag to know which really mapped, and which didn't.

Possibility 2 with bwa; bwa concatenates all the reference contigs together. If your read bridges between two contigs, it will have a map position, but will be flagged as unmapped.

[dariober]

Possibility 2 with bwa; bwa concatenates all the reference contigs together. If your read bridges between two contigs, it will have a map position, but will be flagged as unmapped.

Well spotted!
Indeed the MT chromosome is 16613 bp. Reads are 27 bp long so a map position 16589 means that there are 3 bp going beyond the end of the chr.
Many thanks!

Dario