Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ashwatha
    Member
    • Jul 2011
    • 14

    SAM validation errors

    Hi,

    I need some help understanding these errors when I use picard to validate a SAM/BAM file:


    $java -jar picard-tools-1.50/ValidateSamFile.jar I=somebam.bam
    ERROR: Read groups is empty
    ERROR: Record 38, Read name V15-13:3:73:1694:1074, CIGAR should have zero elements for unmapped read.
    ERROR: Record 37, Read name V15-13:3:73:1694:1074, Mate negative strand flag does not match read negative strand flag of mate

    What does this error mean? I understand why an unmapped read should have zero elements in the CIGAR string, but reads at records 37 and 38 seem to be mapped. Can someone help me understand this error? These are the corresponding records from the SAM file:

    V15-13:3:73:1694:1074 89 chr1 325709 0 69S46M = 325709 0 GTGGCTGACTATGGAAGCCCAAGTCTTCCTCAAATCCGGCTTTTGCCCAACTTCTGACTACTGTCGGACTCTACAGGTCAGCCTCTGCCTCACAGTGGACCCTCCAGACCCAGAT ######################################################################CA,ECEA<EC>AA+BAABB+EC4EGGGGDD<D8BFGDDGGGGGEG XC:i:46 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:5 X1:i:13 XM:i:0 XO:i:0 XG:i:0 MD:Z:46

    V15-13:3:73:1694:1074 181 chr1 325709 0 58M57S = 325709 0 TTCTGGCAGGAGGACTTTTGGCGCCGACATTGGCCGCCAGGCGCTAGACAGGCCCTGGGCCAAAAAAGGCTGTTGTTAGGCAGCGGTTGTGCCGGTGGCCCCAGCCAAGAGGAAG ##########################################################??37B<?35991*9773,+>8@=7>228?B,B775''=-B,BDDGG?EB:F=?@BEE XC:i:58

    Thanks!
    -- Ashwatha.
  • av_d
    Member
    • Sep 2009
    • 12

    #2
    READ: V15-13:3:73:1694:1074
    FLAG: 89
    (read paired, mate unmapped, read reverse strand, first in pair)



    RNAME: chr1

    MRNM: = (? that should not be)

    READ: V15-13:3:73:1694:1074 (mate)
    FLAG: 181
    (read paired, read unmapped, read reverse strand, mate reverse strand, second in pair)

    RNAME: chr1 (? but this read in not mapped)


    you can fix them using FixMateInformation of Picard, otherwise use VALIDATION_STRINGENCY=SILENT

    Comment

    • ashwatha
      Member
      • Jul 2011
      • 14

      #3
      Thank you for the help.

      Comment

      Latest Articles

      Collapse

      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM
      • SEQadmin2
        Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by SEQadmin2


        I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

        Here are nine questions we think about, in roughly the order they matter, before...
        06-18-2026, 07:11 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-02-2026, 11:08 AM
      0 responses
      17 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-30-2026, 05:37 AM
      0 responses
      18 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-26-2026, 11:10 AM
      0 responses
      21 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-17-2026, 06:09 AM
      0 responses
      54 views
      0 reactions
      Last Post SEQadmin2  
      Working...