SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
cufflinks 1.2.0 version got me significantly different results than the old version slowsmile Bioinformatics 9 02-01-2012 02:26 AM
Postdoc at Penn State kmakova Academic/Non-Profit Jobs 0 07-20-2009 10:21 AM
Computational Posts at Wayne State University plattsa Academic/Non-Profit Jobs 1 07-18-2009 09:15 AM
Welcome to the Nanny State...err....California ECO Personalized Genomics 7 06-18-2008 01:34 PM
New York State has a lot of nerve... ECO Personalized Genomics 3 04-21-2008 10:33 AM

Reply
 
Thread Tools
Old 09-14-2011, 02:24 PM   #1
byou678
Member
 
Location: Maryland

Join Date: Aug 2011
Posts: 52
Smile How to clip multiple adapters in Penn State Version Galaxy? Thanks.

Hi All,

In " Clip adapter sequences" option of Penn State Version Galaxy, I choose "Enter custom sequence" under "Source", and I can only enter One custom clipping sequence. So how can I enter another 3 adapter sequences which I want to clip.

In addition, In "What it does" it shows:
This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.

So how could i do if I have the adapter sequences like this:

5' TACACTCTTTCCCTACACGACGCTCTTCCGATCT
5 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
5' GACGGCATACGAGCTCTTCCGATCT
5' AGATCGGAAGAGCTCGTATGCCGTC

Thanks very much for any response!
byou678 is offline   Reply With Quote
Old 09-14-2011, 03:37 PM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Run the tool 4 times if you have 4 adapters

Or install your own Galaxy instance and a more flexible tool, there are some on the Galaxy Tool Shed - http://toolshed.g2.bx.psu.edu/
maubp is offline   Reply With Quote
Old 09-15-2011, 06:15 AM   #3
byou678
Member
 
Location: Maryland

Join Date: Aug 2011
Posts: 52
Smile

Thanks a lot maubp, Running 4 times is really time-consuming

Quote:
Originally Posted by maubp View Post
Run the tool 4 times if you have 4 adapters

Or install your own Galaxy instance and a more flexible tool, there are some on the Galaxy Tool Shed - http://toolshed.g2.bx.psu.edu/
byou678 is offline   Reply With Quote
Reply

Tags
galaxy

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:27 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO