Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dlepp
    Junior Member
    • Mar 2009
    • 5

    Illumina quality scores

    I wonder if someone with more intimate knowledge of the Solexa pipeline could shed some light on the different varieties of quality scores produced and how they relate to one another. Just to be clear, I'm not referring to the difference b/n Solexa and Phred scores or conversion to ascii. From my limited knowledge, there appear to be at least two types of Q-scores produced by the pipeline: intensity-based (found in .prb files from Bustard) and alignment based (found in fastq files from Gerald). There also seems to be some kind of quality calibration going on (using a "precalculated calibration table"?).
    To give some context, I am working with paired-end reads from a bacterial genome using the v1.3 pipeline. I am finding the fastq quality scores are much lower than those from the .prb files (almost entirely Q22 compared to Q40). I'm wondering which scores better represent the quality and why Q22 would be so over-represented in the fastq.

    Thanks!

    BTW, here is a snippet of my fastq file in case I my interpretation is wrong:

    @Paired_run:7:1:305:1931/1
    GAAATAGATGAAGATTTAATTATTGCTCCTAAAT
    +Paired_run:7:1:305:1931/1
    VVVVVVVVVVVVVVVVVVVVVVVVUVVVVVUUUU
    @Paired_run:7:1:315:1920/1
    GACTAAACTGTAGCAATGGTTTAAATGATGATCT
    +Paired_run:7:1:315:1920/1
    VVVVVVVVVVVVVVVVVVVVVVVVVVVVVUUUUU
    @Paired_run:7:1:341:1932/1
    GCTAATGATGTTCTTGATAATTTAAACAAAATTG
    +Paired_run:7:1:341:1932/1
    VVVVVVVVVVVVVVVUVVVVVVVVVVVVVVUUUS
    @Paired_run:7:1:302:1939/1
    GAAATAGATGAAGATTTAATTATTGCTCCTAAAT
    +Paired_run:7:1:302:1939/1
    VVVVVVVVVVVVVVVVVVVVVVVVUVVVVVUUUU
    @Paired_run:7:1:212:1540/1
    GTTAGAATTAATCAAATTGTATGGATGTGTGTAG
    +Paired_run:7:1:212:1540/1
    VUVVVVVVVVVVVVVVVVVUVVUUVVRVSVRUUS
    @Paired_run:7:1:173:757/1
    GTAGACGTATCAGGAGTTTCTAAAGGTAAGGGAT
    +Paired_run:7:1:173:757/1
    VVVVVVVVVVVUVVVVVVVVVVVVVUVVVVUUUU
  • SillyPoint
    Member
    • May 2008
    • 39

    #2
    I didn't know Gerald could produce fastq files directly. We use a perl script to extract information from the *_ub_custom_qseq.txt files produced by Gerald and convert it to fastq format (discarding the non-PF reads in the process). The ascii scores in the qseq files are scaled by 64.

    Can you post the Gerald config file you used to create the fastq?

    SillyPoint

    Comment

    • cbrennan
      Member
      • Dec 2008
      • 28

      #3
      Gerald can generate fasta, fastq, or scarf (default) files.

      for fastq files put the line:

      12345678:SEQUENCE_FORMAT --fastq

      in your Gerald config file.

      Christine
      Christine Brennan
      UM DNA Sequencing Core
      Ann Arbor, MI 48109

      [email protected]

      Comment

      • Sylphide
        Member
        • Feb 2011
        • 11

        #4
        I looked for the meaning of illumina quality scores and couldn't find any direct translation so here it is (in case it is of any use to someone else)

        Illumina quality score dictionary :

        ASCII / numeric / base probability to be wrong
        @ 0 1
        A 1 0.7943282347
        B 2 0.6309573445
        C 3 0.5011872336
        D 4 0.3981071706
        E 5 0.316227766
        F 6 0.2511886432
        G 7 0.1995262315
        H 8 0.1584893192
        I 9 0.1258925412
        J 10 0.1
        K 11 0.0794328235
        L 12 0.0630957344
        M 13 0.0501187234
        N 14 0.0398107171
        O 15 0.0316227766
        P 16 0.0251188643
        Q 17 0.0199526231
        R 18 0.0158489319
        S 19 0.0125892541
        T 20 0.01
        U 21 0.0079432823
        V 22 0.0063095734
        W 23 0.0050118723
        X 24 0.0039810717
        Y 25 0.0031622777
        Z 26 0.0025118864
        [ 27 0.0019952623
        \ 28 0.0015848932
        ] 29 0.0012589254
        ^ 30 0.001
        _ 31 0.0007943282
        ` 32 0.0006309573
        a 33 0.0005011872
        b 34 0.0003981072
        c 35 0.0003162278
        d 36 0.0002511886
        e 37 0.0001995262
        f 38 0.0001584893
        g 39 0.0001258925
        h 40 0.0001
        i 41 7.94328234724282E-005
        j 42 6.30957344480193E-005
        k 43 5.01187233627272E-005
        l 44 3.98107170553497E-005
        m 45 3.16227766016837E-005
        n 46 2.51188643150957E-005
        o 47 1.99526231496888E-005
        p 48 1.58489319246111E-005
        q 49 1.25892541179417E-005
        r 50 0.00001
        s 51 7.94328234724281E-006
        t 52 6.30957344480192E-006
        u 53 5.01187233627272E-006
        v 54 3.98107170553497E-006
        w 55 3.16227766016838E-006
        x 56 2.51188643150958E-006
        y 57 1.99526231496888E-006
        z 58 1.58489319246111E-006
        { 59 1.25892541179417E-006
        | 60 0.000001
        } 61 7.9432823472428E-007
        ~ 62 0.000000631
        Last edited by Sylphide; 02-28-2011, 12:57 AM.

        Comment

        • amitm
          Member
          • Feb 2011
          • 52

          #5
          for converting SCARF format to fastq

          Originally posted by Sylphide View Post
          I looked for the meaning of illumina quality scores and couldn't find any direct translation so here it is (in case it is of any use to someone else)

          Illumina quality score dictionary :

          text illumina_score
          @ 0
          A 1
          B 2
          .
          .
          .
          hello Sylphide,
          Just to reconfirm. Can I use this conversion table to convert quality score in SCARF ASCII format to SCARF numeric, so that I can then use 'fq_all2std.pl' (from Maq site) to generate standard fastq format. The script assumes the quality score in .scarf file to be in numeric form whereas I have the files with scores in ASCII form.
          I'm a beginner in sequencing data analysis. Kindly help out
          thanks

          Comment

          • Sylphide
            Member
            • Feb 2011
            • 11

            #6
            hello
            I'm also a beginner but I'll try to help.
            You can use the conversion table I wrote to convert ASCII to numeric if you want to program it yourself. There must be some tool to make the conversion automatically but I couldn't find any.

            ps : I added the probability for a base to be wrong in my previous message.

            Comment

            • amitm
              Member
              • Feb 2011
              • 52

              #7
              hello Sylphide,
              I cleared my confusion from here. Basically what I understood is Solexa quality in ASCII is encoded with an offset of 33 whereas Illumina 1.3+ quality has an offset of 64. Now I can parse the .scarf file if I have to.
              There are many tools to convert between qualities, but I know of only one which is free and accepts .scarf input. Thats the "fq_all2std.pl" from Maq site.
              thanks anyways! I started hunt around about quality encoding from your post :-)

              Comment

              Latest Articles

              Collapse

              • GATTACAT
                Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by GATTACAT
                Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                07-01-2026, 11:43 AM
              • SEQadmin2
                Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by SEQadmin2


                I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                Here are nine questions we think about, in roughly the order they matter, before...
                06-18-2026, 07:11 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 07-02-2026, 11:08 AM
              0 responses
              12 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-30-2026, 05:37 AM
              0 responses
              14 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-26-2026, 11:10 AM
              0 responses
              20 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-17-2026, 06:09 AM
              0 responses
              54 views
              0 reactions
              Last Post SEQadmin2  
              Working...