![]() |
|
|||||||
Similar Threads
|
||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| Get fasta amino-acid BLAST result | aliealexandre | Bioinformatics | 5 | 09-24-2012 10:23 AM |
| Local BLAST result annotation | kvtspavan | Bioinformatics | 0 | 05-24-2011 11:12 PM |
| BLAST result | rdu | Bioinformatics | 0 | 04-28-2011 10:22 AM |
| BLAST output parsing in R? | rdu | Bioinformatics | 3 | 01-25-2011 06:25 AM |
| Parsing BLAST results using BioPerl | Ben Saville | Bioinformatics | 8 | 08-24-2010 07:43 AM |
![]() |
|
|
Thread Tools |
|
|
#1 |
|
Member
Location: ITALY Join Date: Oct 2010
Posts: 86
|
Hy everybody,
in this situation froma blast (-m 1) result file : Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= 132-291 (59 letters) Database: Scrivania/orchidea/mature_mirBase.fa 21,643 sequences; 470,608 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value mtr-miR2644b MIMAT0013413 Medicago truncatula miR2644b 28 0.031 mtr-miR2644a MIMAT0013412 Medicago truncatula miR2644a 28 0.031 gga-miR-1704 MIMAT0007596 Gallus gallus miR-1704 22 1.9 gga-miR-1557 MIMAT0007414 Gallus gallus miR-1557 22 1.9 mmu-miR-880-5p MIMAT0017266 Mus musculus miR-880-5p 22 1.9 132_0 8 cagccgctcagattgatggtgcctacagccttgccagcccgctcagattgat 59 12631 5 .............. 18 12630 5 .............. 18 7826 5 ........... 15 7644 19 ........... 9 5394 3 ........... 13 5394 3 ........... 13 BLASTN 2.2.21 [Jun-14-2009] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ... .... .......... ______________________________________________________________ I need to parse in an exel sheet : 1)ID 2)Name of the hit 3)E-value 4)Score 5)Species 1) 132-291 2)mir2644b 3) 0,031 4)28 5) Medicago truncatula Is possible from a big blast result file obtain an exel with 5 columns where every field is the first hit of the blast result. Can anyone halp me to fix this problem ??? Also with a little script in perl. Thank you very much |
|
|
|
|
|
#2 |
|
not just another member
Location: Belgium Join Date: Aug 2010
Posts: 246
|
use -m 8 for tabular output and then import in excel
|
|
|
|
|
|
#3 |
|
Member
Location: ITALY Join Date: Oct 2010
Posts: 86
|
I know the -m 8 view but give me another result respect to m1 with lack of information. So i ask you a little script to handle the txt file and parse it on exel.
|
|
|
|
|
|
#4 |
|
Peter (Biopython etc)
Location: Dundee, Scotland, UK Join Date: Jul 2009
Posts: 1,170
|
You really don't want to try and use Excel for parsing plain text BLAST output. Parsing plain text BLAST output is annoying enough in a proper language like Perl or Python - BioPerl, Biopython and the NCBI don't recommend it. Rather they recommend to use the tabular output (simpler) or the XML ouput (richer).
Note BLAST+ lets you request quite a lot of extra columns of information in the tabular output. If that still isn't enough, I would write a script (not using Excel) to parse the extra information from the XML BLAST output. In fact, you really shouldn't want to use Excel for Bioinformatics in the first place. One very nicely documented reason is here http://dx.doi.org/10.1186/1471-2105-5-80 Last edited by maubp; 11-15-2011 at 03:57 AM. Reason: Note about BLAST+ extra columns in tabular output; recommendation |
|
|
|
|
|
#5 |
|
Member
Location: ITALY Join Date: Oct 2010
Posts: 86
|
Thanks you very much, i did not know about this limit, i'll read the paper.
Cheers |
|
|
|
|
|
#6 |
|
Peter (Biopython etc)
Location: Dundee, Scotland, UK Join Date: Jul 2009
Posts: 1,170
|
I see you're opting for Perl, in which case using BioPerl to parse the BLAST text output is a very good idea: http://lists.open-bio.org/pipermail/...er/035872.html
|
|
|
|
|
|
#7 |
|
Member
Location: ITALY Join Date: Oct 2010
Posts: 86
|
Yes, infact !!! Thanks you very much !!!
|
|
|
|
![]() |
| Thread Tools | |
|
|