SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Get fasta amino-acid BLAST result aliealexandre Bioinformatics 5 09-24-2012 10:23 AM
Local BLAST result annotation kvtspavan Bioinformatics 0 05-24-2011 11:12 PM
BLAST result rdu Bioinformatics 0 04-28-2011 10:22 AM
BLAST output parsing in R? rdu Bioinformatics 3 01-25-2011 06:25 AM
Parsing BLAST results using BioPerl Ben Saville Bioinformatics 8 08-24-2010 07:43 AM

Reply
 
Thread Tools
Old 11-15-2011, 12:23 AM   #1
Giorgio C
Member
 
Location: ITALY

Join Date: Oct 2010
Posts: 86
Default Blast > parsing result in Exel

Hy everybody,

in this situation froma blast (-m 1) result file :

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= 132-291
(59 letters)

Database: Scrivania/orchidea/mature_mirBase.fa
21,643 sequences; 470,608 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

mtr-miR2644b MIMAT0013413 Medicago truncatula miR2644b 28 0.031
mtr-miR2644a MIMAT0013412 Medicago truncatula miR2644a 28 0.031
gga-miR-1704 MIMAT0007596 Gallus gallus miR-1704 22 1.9
gga-miR-1557 MIMAT0007414 Gallus gallus miR-1557 22 1.9
mmu-miR-880-5p MIMAT0017266 Mus musculus miR-880-5p 22 1.9

132_0 8 cagccgctcagattgatggtgcctacagccttgccagcccgctcagattgat 59
12631 5 .............. 18
12630 5 .............. 18
7826 5 ........... 15
7644 19 ........... 9
5394 3 ........... 13
5394 3 ........... 13
BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
...
....
..........

______________________________________________________________
I need to parse in an exel sheet :

1)ID 2)Name of the hit 3)E-value 4)Score 5)Species


1) 132-291 2)mir2644b 3) 0,031 4)28 5) Medicago truncatula


Is possible from a big blast result file obtain an exel with 5 columns where every field is the first hit of the blast result. Can anyone halp me to fix this problem ??? Also with a little script in perl.


Thank you very much
Giorgio C is offline   Reply With Quote
Old 11-15-2011, 12:28 AM   #2
NicoBxl
not just another member
 
Location: Belgium

Join Date: Aug 2010
Posts: 246
Default

use -m 8 for tabular output and then import in excel
NicoBxl is offline   Reply With Quote
Old 11-15-2011, 01:34 AM   #3
Giorgio C
Member
 
Location: ITALY

Join Date: Oct 2010
Posts: 86
Default

I know the -m 8 view but give me another result respect to m1 with lack of information. So i ask you a little script to handle the txt file and parse it on exel.
Giorgio C is offline   Reply With Quote
Old 11-15-2011, 03:51 AM   #4
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,170
Default

You really don't want to try and use Excel for parsing plain text BLAST output. Parsing plain text BLAST output is annoying enough in a proper language like Perl or Python - BioPerl, Biopython and the NCBI don't recommend it. Rather they recommend to use the tabular output (simpler) or the XML ouput (richer).

Note BLAST+ lets you request quite a lot of extra columns of information in the tabular output. If that still isn't enough, I would write a script (not using Excel) to parse the extra information from the XML BLAST output.

In fact, you really shouldn't want to use Excel for Bioinformatics in the first place. One very nicely documented reason is here http://dx.doi.org/10.1186/1471-2105-5-80

Last edited by maubp; 11-15-2011 at 03:57 AM. Reason: Note about BLAST+ extra columns in tabular output; recommendation
maubp is offline   Reply With Quote
Old 11-15-2011, 05:17 AM   #5
Giorgio C
Member
 
Location: ITALY

Join Date: Oct 2010
Posts: 86
Default

Thanks you very much, i did not know about this limit, i'll read the paper.

Cheers
Giorgio C is offline   Reply With Quote
Old 11-16-2011, 12:12 AM   #6
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,170
Default

I see you're opting for Perl, in which case using BioPerl to parse the BLAST text output is a very good idea: http://lists.open-bio.org/pipermail/...er/035872.html
maubp is offline   Reply With Quote
Old 11-16-2011, 12:16 AM   #7
Giorgio C
Member
 
Location: ITALY

Join Date: Oct 2010
Posts: 86
Default

Yes, infact !!! Thanks you very much !!!
Giorgio C is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:21 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.