Tweet
When I run the software, it returns an error.
you can see it in the attachment, please give me some suggestion.
thank you very much.
you can see it in the attachment, please give me some suggestion.
thank you very much.
-
-
As the error states, "Sequence must start with @: >@ ..." Meaning that Picard is trying to read the sequence and is failing. It calls the method FastqToSam but the file you gave it is in fasta format. You need to convert it beforehand (remove the '>' at the beginning of lines) -
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I opened and detected my data file, But i didn't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
would you try plat text file , not the gz file?Comment
-
It's OK. Thanks a lot.Comment
-
If I run Estimatelibrarycomplexity.jar, it seems that the data format is wrong again.
ERROR: Error parsing SAM header. Unrecognized header record type. Line: @HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:Comment
-
how do you solved your hard problem?Comment
-
Spatial biology is an exciting field that encompasses a wide range of techniques and technologies aimed at mapping the organization and interactions of various biomolecules in their native environments. As this area of research progresses, new tools and methodologies are being introduced, accompanied by efforts to establish benchmarking standards and drive technological innovation.
3D Genomics
While spatial biology often involves studying proteins and RNAs in their...01-01-2025, 07:30 PM -
Many organizations study rare diseases, but few have a mission as impactful as Rady Children’s Institute for Genomic Medicine (RCIGM). “We are all about changing outcomes for children,” explained Dr. Stephen Kingsmore, President and CEO of the group. The institute’s initial goal was to provide rapid diagnoses for critically ill children and shorten their diagnostic odyssey, a term used to describe the long and arduous process it takes patients to obtain an accurate...12-16-2024, 07:57 AM
Comment