When I run the software, it returns an error.
you can see it in the attachment, please give me some suggestion.
thank you very much.
you can see it in the attachment, please give me some suggestion.
thank you very much.
-
-
As the error states, "Sequence must start with @: >@ ..." Meaning that Picard is trying to read the sequence and is failing. It calls the method FastqToSam but the file you gave it is in fasta format. You need to convert it beforehand (remove the '>' at the beginning of lines) -
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I opened and detected my data file, But i didn't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
would you try plat text file , not the gz file?Comment
-
It's OK. Thanks a lot.Comment
-
If I run Estimatelibrarycomplexity.jar, it seems that the data format is wrong again.
ERROR: Error parsing SAM header. Unrecognized header record type. Line: @HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:Comment
-
how do you solved your hard problem?Comment
-
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...07-31-2026, 11:01 AM
Comment