SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to convert .txt file to .bed or .gff, How can we use chip seq data in R software forevermark4 Bioinformatics 56 01-19-2012 08:26 AM
Is there a tool that converts TXT, BED, GFF format to VCF? LauraSmith Bioinformatics 3 12-05-2011 11:32 AM
Is it possible to convert a SNP.txt to a bed file or get a SNP.bed from samtools? Ling Bioinformatics 3 02-06-2010 06:33 PM
How to transform BAM format to .TXT or .BED? zhenshao Bioinformatics 3 01-11-2010 10:31 AM
s_#_sorted.txt files caza Bioinformatics 2 04-28-2009 08:12 AM

Reply
 
Thread Tools
Old 02-07-2012, 12:14 PM   #1
apche93
Junior Member
 
Location: united states

Join Date: Feb 2012
Posts: 1
Default s_#_sorted.txt to BED

Hi all,

I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.

Code:
HWI-EAS240      FC2087UAAXX     3       257     951     322                     TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT    [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS    chr10.fasta             53590   R       33G2    0

I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.

Thanks in advance!
apche93 is offline   Reply With Quote
Reply

Tags
bed, conversion, eland sorted, sorted.txt

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:17 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.