SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa

Similar Threads
Thread Thread Starter Forum Replies Last Post
Homemade TruSeq adapters sebbaba Illumina/Solexa 2 09-09-2013 09:26 AM
TruSeq methylated adapters? epistatic Illumina/Solexa 3 09-06-2013 01:24 PM
Using TruSeq adapters with older protocols- not working? jlove Illumina/Solexa 2 12-01-2011 01:11 PM
Library prep for 50ng input with TruSeq DNA- or RNAseq adapters? sehrrot Sample Prep / Library Generation 1 11-09-2011 05:03 AM
TruSeq DNA adapters in RNA-seq prep... concentration? ScottC Sample Prep / Library Generation 4 09-10-2011 03:38 AM

Reply
 
Thread Tools
Old 11-04-2014, 05:43 AM   #1
Asashoryu
Junior Member
 
Location: NL

Join Date: May 2009
Posts: 4
Default 4C-seq with Truseq adapters on Nextseq500 problem

I tried to do some 4C sequencing pilots on Nextseq500 platform. I've used these primers to finally amplify my library before sequencing:

AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCT | Truseq Reading adapter
CAAGCAGAAGACGGCATACGA | Non-reading adapter

these sequences are used by many people to do 4C libraries compatible with illumina.

amplification went well, qPCR test went OK (sequences necessary for cluster generation and sequencing primer is there), we size selected the library to remove all above 700bp...

Problem is that the run failed twice, with no clusters detected. Machine is OK, all runs before and after these samples were OK. technicians are very experienced, last months there were no runs failing due to their mistakes so expecting that they did something stupid just for these 2 runs is not very probable. PhiX spike in worked...

Can someone have a hint what went wrong?
Asashoryu is offline   Reply With Quote
Old 11-04-2014, 05:31 PM   #2
kcchan
Senior Member
 
Location: USA

Join Date: Jul 2012
Posts: 159
Default

The NextSeq uses PE adapters on their flow cells. What you have listed are the older SR/Solexa adapters which only work on SR flow cells on the GA and HiSeq. You will need to modify your primers to include the PE adapter sequences before it can be sequenced on a NextSeq or MiSeq.
kcchan is offline   Reply With Quote
Old 11-05-2014, 07:29 AM   #3
Asashoryu
Junior Member
 
Location: NL

Join Date: May 2009
Posts: 4
Default

Thanks for the reply! Indeed it makes sense now.
Asashoryu is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:31 AM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.