Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • pbrand
    Member
    • Feb 2012
    • 13

    #1

    Interesting Behavior: The megablast standalone behaves as blastn.. Who knows why???

    Hi all,
    I am using the blastn standalone with the MEGABLAST algorithm to find contaminations in my illumina Hymenopteran database prior to assembly.

    I observed the interesting instance, that when I use the nuccore db as database to blast against, the found best blast hits aren't the same as when I use a custom Hymenoptera database (all hymenopteran sequences of ncbi) without changing any other settings.

    Now you think: "Clear thing, it's because of the databases! You cannot find anything that is not there"

    BUT:

    When I test reads with hits on both approaches on the ncbi-web-blast, I get the same behavior as described above when I search one time using the MEGABLAST algorithm (the same hit as against nuccore) and the other time using the blastn algorithm (the same hit as against hymenoptera-DB) WITHOUT changing the database!!!!!!!

    (just to point it out: that means, that the behavior is not related to the different databases but to the algorithm!)

    You can try it at the web blast if you want:

    GAAAAAAAGACAGTTGCGTATCATGAGGCTGGCCATGCAGTAGCAGGCTGGTTTTTACAATACGCAGATCCACTTTTAAAGGTCTCTATAATCCCACGTGG

    bbh with megablast: NM_001079291.1 Xenopus e-15
    bbh with blastn: XM_003693554.1 Apis e-28

    bbh standalone megablast nuccore: NM_001079291.1 Xenopus e-15
    bbh standalone megablast hym-DB: XM_003693554.1 Apis e-28

    That is totally strange, isn't it?

    Why does my standalone megablast find Apis just when I use the custom hymenopt. DB, not in the nuccore? Does it act as dc-megablast or blastn by itself in special circumstances?

    Does anyone know if the standalone blastn Megablast changes any settings like word size on it's own? Can anyone explain this strange behavior?

    I would be happy to hear any of your expectations.

    Cheers,
    Phil

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM
  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-03-2026, 10:13 AM
0 responses
21 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-31-2026, 02:55 AM
0 responses
35 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
25 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-23-2026, 11:41 AM
0 responses
21 views
0 reactions
Last Post SEQadmin2  
Working...