Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Apex
    Junior Member
    • Mar 2011
    • 4

    #1

    Complete ligation adaptor sequences

    Hello everyone,

    I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq:

    Forward primer (Primer A-key):
    5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’
    Reverse primer (Primer P1-key):
    5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’

    For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR.

    Does anyone have this sequence of the ligation adaptors?

    I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself.
  • Apex
    Junior Member
    • Mar 2011
    • 4

    #2
    Exactly what I was looking for! Thank you very much genseq!

    Comment

    • IonTorrent
      Member
      • Jan 2010
      • 64

      #3
      Hi Apex,

      The sequences of the fragment library adaptors can be found in Appendix D (pp. 45) of the current Ion Xpress™ Plus gDNA Fragment Library Preparation User Guide, as available on the Ion Community.

      Ion AmpliSeq™ Custom Panels may be designed using the Ion AmpliSeq™ Designer website.


      Originally posted by Apex View Post
      Hello everyone,

      I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq:

      Forward primer (Primer A-key):
      5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’
      Reverse primer (Primer P1-key):
      5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’

      For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR.

      Does anyone have this sequence of the ligation adaptors?

      I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself.

      Comment

      • JoF
        Junior Member
        • Aug 2014
        • 2

        #4
        adaptor sequences for Ion S5

        Hi,
        I'm new to Life Tech semi conductor Sequencing and only have MiSeq experience. We were offered a demo run of the Ion S5 and I would like to produce the library beforehand with our custom protocol.

        Can anyone tell me if the Ion torrent adaptors are the same for the Ion S5?

        Fwd: CCATCTCATCCCTGCGTGTCTCCGACTCAG

        Rev: CCTCTCTATGGGCAGTCGGTGAT

        cheers,
        JoF

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, Today, 10:05 AM
        0 responses
        8 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-13-2026, 12:22 PM
        0 responses
        32 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-11-2026, 10:35 AM
        0 responses
        27 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-06-2026, 07:41 AM
        0 responses
        38 views
        0 reactions
        Last Post SEQadmin2  
        Working...