SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
truncation of contig in velvet deprekate Bioinformatics 0 10-25-2012 04:24 PM
Contig vs contig or map against contig lib? JackieBadger Bioinformatics 0 06-24-2012 02:48 PM
Failure of transforming Velvet .afg file into GDE .contig file ZhigangLi Bioinformatics 0 11-25-2010 05:03 PM
Get coverage of each site on contig generated by Velvet genelab Bioinformatics 4 09-18-2010 01:25 AM
solid_denovo_postprocessor.pl removes velvet contig sequence. KevinLam Bioinformatics 0 02-09-2010 05:04 PM

Reply
 
Thread Tools
Old 01-30-2013, 10:55 PM   #1
hard998
Junior Member
 
Location: beijing

Join Date: Jun 2009
Posts: 4
Default contig overlaps in velvet 1.2.03

Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,

However, when I examined the contig.fa output by velvet, eg
>NODE_1331_length_2655_cov_63.920151
>NODE_1395_length_1978_cov_42.813953
...

I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
||||||||||||||||||||||||||||||||||||||||||||
NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979


Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!
hard998 is offline   Reply With Quote
Old 02-04-2013, 07:52 PM   #2
seb567
Senior Member
 
Location: Québec, Canada

Join Date: Jul 2008
Posts: 237
Default

Quote:
Originally Posted by hard998 View Post
Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,

However, when I examined the contig.fa output by velvet, eg
>NODE_1331_length_2655_cov_63.920151
>NODE_1395_length_1978_cov_42.813953
...

I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
||||||||||||||||||||||||||||||||||||||||||||
NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979


Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!
These are called repeats. You probably have more than 2 contigs with this sequence on one end. Therefore, Velvet did not merge them because that would cause an assembly error, which produce chimeric contigs.
seb567 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:27 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.