Are public CG reads SE reads or PE reads?

gene coder

Member

Join Date: Jul 2011
Posts: 18

Are public CG reads SE reads or PE reads?

03-05-2013, 03:26 AM

I was running

Code:

head -20

on the file ftp://ftp2.completegenomics.com/YRI_...01_013.tsv.bz2. The output suggests that the reads are single-end. Or are they paired-end?

Output:

Code:

#ASSEMBLY_ID    NA19240-L2-200-37-ASM
#BATCH_FILE_NUMBER      13
#BATCH_OFFSET   360000000
#FIELD_SIZE     476288
#FORMAT_VERSION 2.0
#GENERATED_AT   2011-Oct-08 20:47:05.612947
#GENERATED_BY   exportTools
#LANE   L01
#LIBRARY        GS00700-CLS_G07
#SAMPLE GS00706-DNA_C01
#SLIDE  GS27651-FS3
#SOFTWARE_VERSION       2.0.0.26
#TYPE   READS

>flags  reads   scores
5       CTCAAAATCCTAAGCCAAAAGAACAAGGCATCACCTGTTTGCAGAATTGTATATCTAGAAAACCCCCCAT  8:9;;+/378788876;<<<;;:;:()/085280.2847856164:99;;9;;8818888497347;979
4       AATTCTCTGCTTCCAGTGTGGCCCACCAAAAGACTTCTTCCTGCAGGCTGACTTCATAACTTCAGACATA  899;;)72)6784766:;<<::98/888988620.377776656&:6:;;08;:888579446,475915
5       ACTTCTCAGTAAAGTAGGGTTTAGTAAAAGGACTTCAGTGCAGGGCGCCACAGTTTAAGCCAAAAAAGAA  9::;668-57778875:<<;;;+;;999693680.358626+3*677;;:<:<:87988878679;;)::
0       AGCAGAGGAGACCTGAATTCATTTCCTACTTTCAATGCTGTGTGTACTTAGACCACCCACTGTTTTTGAG  88:;:83845788776;:<;%<*+)895588880.*7&7840(62(:8;-<68;88888))22/4::9:9
0       GGAGGGGCCAAGGCCGGCAGAGTGCCTCAGGAGTTGAGTTCGAGCGGGCCAACACGGTAAAACCTCTGGT  81:;676787-*)416;8;3;;:;:88188..*0%0827.7130()%&'$-;32864828542567:999

Tags: complete genomics, paired end reads, single end

Previous template Next

Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems

by SEQadmin2

Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...
- Channel: Articles
07-09-2026, 11:10 AM
Cancer Drug Resistance: The Lingering Barrier to Rising Survival

by SEQadmin2

Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
- Channel: Articles
07-08-2026, 05:17 AM
Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing

by GATTACAT

Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
- Channel: Articles
07-01-2026, 11:43 AM

Topics	Statistics	Last Post
UC San Diego Bioengineers Map Gene Function in Human Stem Cells by SEQadmin2 Started by SEQadmin2, 07-13-2026, 10:26 AM	0 responses 20 views 0 reactions	Last Post by SEQadmin2 07-13-2026, 10:26 AM
New Analysis Splits Leukemia Into 16 Epigenomic Subgroups by SEQadmin2 Started by SEQadmin2, 07-09-2026, 10:04 AM	0 responses 31 views 0 reactions	Last Post by SEQadmin2 07-09-2026, 10:04 AM
Genome-Wide CRISPR Screen Uncovers Unlikely Psoriasis Target by SEQadmin2 Started by SEQadmin2, 07-08-2026, 10:08 AM	0 responses 20 views 0 reactions	Last Post by SEQadmin2 07-08-2026, 10:08 AM
Engineered Protein Motor Takes Its First Steps Along DNA Track by SEQadmin2 Started by SEQadmin2, 07-07-2026, 11:05 AM	0 responses 34 views 0 reactions	Last Post by SEQadmin2 07-07-2026, 11:05 AM

Unconfigured Ad

Are public CG reads SE reads or PE reads?

Latest Articles

ad_right_rmr

News