Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • chengusf
    Junior Member
    • Nov 2012
    • 4

    Illumina small RNA adapter sequence

    Hi,

    I am asking a help for Illumina small rna sequencing data analysis. I got the small RNA sequencing data and am doing data analysis. However I have a question of small RNA adapter sequence. Here is some part of fasta file. Could you tell me which part is adapter sequence of the adapter (GCCAAT is the bar code)? I cannot find it in the website manual. Could you do me a favor? Thanks!

    @HWI-H232:62:C1AV0ACXX:8:1308:20071:200816 1:N:0:GCCAAT
    CCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGT
    +
    @@@FAADAFHHHHJIII;FFHHIJFGHIEGIGIGHJEIIGIIIIJGIIJH
    @HWI-H232:62:C1AV0ACXX:8:1308:20244:200844 1:N:0:GCCAAT
    GCGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCT
    +
    ?<@44@A2<2+CBFDFGB=E18?CF9:B;BFEFE?39?FE<FFFIEEEFI
    @HWI-H232:62:C1AV0ACXX:8:1308:20073:200869 1:N:0:GCCAAT
    CTCTCCGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATA
    +
    @@@FFFDDHHGHDICHIIIEHII:CDHGIIIIIHGGI>GDGHIECHIIIC
    @HWI-H232:62:C1AV0ACXX:8:1308:20042:200910 1:N:0:GCCAAT
    ACGGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTC
    +
    @C@FDFFFHHGHHJIJJGIGIGIJGHIJHHHIIJJJJJJIIJJIGIJJJJ
  • kcchan
    Senior Member
    • Jul 2012
    • 186

    #2
    You'll have to look at Illumina's customer sequence letter to find all of the adapter sequences. The 3' adapters will begin with the sequence TGGAATTCTCGGGTGCCAAGG and end with the barcode and P7 adapters.

    Comment

    • chengusf
      Junior Member
      • Nov 2012
      • 4

      #3
      I checked several samples. You are right. Thank you so much!

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by SEQadmin2


        I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


        Here are nine questions we think about, in roughly the order they matter, before...
        06-18-2026, 07:11 AM
      • SEQadmin2
        From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
        by SEQadmin2


        Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


        The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
        ...
        06-02-2026, 10:05 AM
      • SEQadmin2
        Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
        by SEQadmin2


        With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


        Introduction

        Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
        05-22-2026, 06:42 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 06-17-2026, 06:09 AM
      0 responses
      21 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-09-2026, 11:58 AM
      0 responses
      38 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-05-2026, 10:09 AM
      0 responses
      45 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-04-2026, 08:59 AM
      0 responses
      49 views
      0 reactions
      Last Post SEQadmin2  
      Working...