how to delete the all fastq reads which includes a potential 50bp Illumina Single End

[rzeng]

HI,

I did Fastqc and found that a potential 50bp illumina single End PCR primer 1 sequence in my reads as followings

AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA (100% over 30bp)

I checked my reads and found that this 50bp sequence locates on 5' of my reads that account 0.25% of all reads. (also some of my reads that there are GCGCA/GCTCAG/AACCG/AACAAAAGG sequence before this 50bp sequence too))

Since my reads are all 88bp length. I do not want to keep these reads even if I cut these 50bp sequence off.

Anyone know if there is any tools that can get rid of these reads who contain this 50bp sequence in the read? Or anyone has scripts or other ways to do this?

[rzeng]

My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account for 0.25%. Fastq toolkit trimmer or other tools can not help.

[rhinoceros]

Map your reads against this sequence with something like bowtie2?

[rzeng]

No. I need to remove these reads which contain this 50bp sequence noisy from my library before I map them with BWA

[GenoMax]

If the reads only account for 0.25% of total why are you worried about them?

[kmcarr]

Use a read filtering/trimming application which includes adapter detection and removal. My choice is Trimmomatic.

[dariober]

My aim for above question is that I want to get rid of these reads which contain AGTTGATCCGGTCCTAGGCAGTGTAGATCTCGGTGGTCGCCGTATCATTA sequence. since the reads contained this 50bp sequence only account for 0.25%. Fastq toolkit trimmer or other tools can not help.

For example I would use cutadapt with "--discard-trimmed" option. Anyway, as GenoMax suggested you might ignore these reads which wouldn't align anyway if the adapter makes up a big chunk of the read.
Dario

[FroggyFlox]

If you don't want to deal with Trimmomatic, you can also have a look at the Galaxy platform... Use the tool called 'Manipulate Fastq' which will give you the possibilty to select all the reads containing your sequence and do whatever you want with them, including deleting them.

https://main.g2.bx.psu.edu/

[rzeng]

Thank you all the guys