Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Mr Mutundes
    Member
    • Jan 2009
    • 17

    sam output from bwa colorspace alignment

    Hi,

    I am trying bwa with SOLiD input but encounter a problem with the SAM output. Reads aligned to the - strand are stored in such a way that using them in e.g. samtools pileup or samtools tview does not report the alignment properly.

    How to easily reproduce the problem:

    #prepare a short reference sequence using the samtools example sequence:
    head -3 /usr/local/samtools-0.1.6/examples/ex1.fa > ref.fa
    samtools faidx ref.fa
    qbwa index -c -p ref -a is ref.fa

    #simulate a few SOLiD reads with no mismatches:
    wgsim -c -e 0.0 -d 110 -s 0.00001 -N 10 -1 50 -2 50 -r0.0 -R 0.0 ref.fa sim_F3.fq sim_R3.fq

    #align:
    bwa aln -c ref sim_F3.fq > sim_F3.sai
    bwa aln -c ref sim_R3.fq > sim_R3.sai
    bwa sampe ref sim_R3.sai sim_F3.sai sim_R3.fq sim_F3.fq > sim.sam

    #reformat:
    samtools import ref sim.sam sim.unsorted.bam
    samtools sort sim.unsorted.bam sim
    samtools index sim.bam

    #display alignments with tview (and edit, copy and paste output):
    samtools tview sim.bam ref.fa

    1 11 21 31 41 51
    CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCT
    ........A..AACA...ACACACCAAA...A.CA...ACC....C..AATCCCTC
    .................................................
    .................................................
    atcaccgagtaacatttacacaccaaattgagcaggtaccgggtcgtaa
    .................................................
    accgagtaacatttacacaccaaattgagcaggtaccgggtcgtaatcc
    .................................................
    .................................................
    gagtaacatttacacaccaaattgagcaggtaccgggtcgtaatccctc
    gagtaacatttacacaccaaattgagcaggtaccgggtcgtaatccctc
    gagtaacatttacacaccaaattgagcaggtaccgggtcgtaatccctc

    61 71 81 91 101 111
    GTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACNNNN
    ........AC..C..ACC.ACACCCCC..C..CACC.AC.CCCCAC..CTCGGCTC
    .................................................
    .................................................
    acctgggacgtcggaccgacacccccggcgtcaccgactccccacgtct
    .................................................
    tgggacgtcggaccgacacccccggcgtcaccgactccccacgtctcgg
    .................................................
    .................................................
    gacgtcggaccgacacccccggcgtcaccgactccccacgtctcggctc
    gacgtcggaccgacacccccggcgtcaccgactccccacgtctcggctc
    gacgtcggaccgacacccccggcgtcaccgactccccacgtctcggctc


    #pileup:
    samtools pileup -c -f ref.fa sim.bam | head -10
    seq1 3 C C 10 0 37 1 ^F. +
    seq1 4 T T 8 0 37 3 .^F.^Fa +++
    seq1 5 A A 15 0 37 4 ..t^F. ++++
    seq1 6 G G 15 0 37 4 ..c. ++++
    seq1 7 T T 7 0 37 5 ..a.^Fa +++++
    seq1 8 G G 12 0 37 6 ..c.c^F. ++++++
    seq1 9 G G 17 0 37 7 ..c.c.^F. +++++++
    seq1 10 C C 0 0 37 10 ..g.g..^Fg^Fg^Fg ++++++++++
    seq1 11 T A 0 0 37 10 ..a.a..aaa ++++++++++
    seq1 12 C C 0 0 37 10 ..g.g..ggg ++++++++++


    The above outputs look a bit messy here but it's clear that half of the reads are displayed as not matching the reference sequence, which is not the case. Reads in the SAM file which have a flag field value of 65 or 129 (half of them) have a sequence in the SEQ field that can be found within the + strand of the reference sequence. In contrast the reads in the SAM file that have a flag filed value of 113 or 177 have a sequence which is the complement of part of the reference sequence (but not the reverse complement) e.g.:

    seq1_56_114_0:0:0_0:0:0_1 113 seq1 7 37 49M = 65 58 ACCGAGTAACATTTACACACCAAATTGA
    GCAGGTACCGGGTCGTAATCC +++++++++++++++++++++++++++++++++++++++++++++++++ XT:A:U CM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i

    (sorry about the wrapping)

    This line reports ACCGAG..etc which is actually the complement of part of the reference sequence (GTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGG). SO there are good alignments but they are not stored correctly in the sam file because the SAM specification say that "All mapped reads are represented on the forward genomic strand."

    So am I doing something dumb or is this a problem with the way BWA produces sam format output?

    Thanks for any advice or comments.

    Mr M

Latest Articles

Collapse

  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
24 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
21 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
34 views
0 reactions
Last Post SEQadmin2  
Working...