MACS-ChIP seq-Error

[repinementer]

Traceback (most recent call last):
  File "/home/taoliu/bin/macs", line 273, in <module>
    main()
  File "/home/taoliu/bin/macs", line 71, in main
    options.bg_redundant = bg_r (treat,options.max_dup_tags) # average
  File "/home/taoliu/bin/macs", line 225, in bg_r
    return float(total_duplicates)/(total_tags)
ZeroDivisionError: float division

I used the foolwing command and got above error. Is any one know what this is?

$ macs --format ELAND -t CMM028_191_unique_hits.txt -c CMM027_027_unique_hits.txt --name=CM28 --gsize=2473000000 --tsize=35 --mfold=25 --diag --wig

[Xi Wang]

First of all, you should check your Eland format, make sure it follows the following description, which is copied from MACS manual: http://liulab.dfci.harvard.edu/MACS/00README.html

If the format is ELAND, the file must be ELAND output file, each line MUST represents only ONE tag, with fields of:

1. Sequence name (derived from file name and line number if format is not Fasta)
2. Sequence
3. Type of match: NM - no match found. QC - no matching done: QC failure (too many Ns basically). RM - no matching done: repeat masked (may be seen if repeatFile.txt was specified). U0 - Best match found was a unique exact match. U1 - Best match found was a unique 1-error match. U2 - Best match found was a unique 2-error match. R0 - Multiple exact matches found. R1 - Multiple 1-error matches found, no exact matches. R2 - Multiple 2-error matches found, no exact or 1-error matches.
4. Number of exact matches found.
5. Number of 1-error matches found.
6. Number of 2-error matches found. Rest of fields are only seen if a unique best match was found (i.e. the match code in field 3 begins with "U").
7. Genome file in which match was found.
8. Position of match (bases in file are numbered starting at 1).
9. Direction of match (F=forward strand, R=reverse).
10. How N characters in read were interpreted: ("."=not applicable, "D"=deletion, "I"=insertion). Rest of fields are only seen in the case of a unique inexact match (i.e. the match code was U1 or U2).
11. Position and type of first substitution error (e.g. 12A: base 12 was A, not whatever is was in read).
12. Position and type of first substitution error, as above.

[repinementer]

Yep. Thanx

Ya I found out my format is GERALD(-Illumina). Wasted almost 3 hours to convert GERALD to BED or ELAND. Still no result.

Found a perl script but it's for Solexa and Peakfinder package (Unfortunately jar files are not working (May be some Java file installation problems in my PC)).

Now writing my own script to modify the format......

[repinementer]

Could any one post GERALD format with simple text file and ELAND format with a simple text file.

Thanx

[repinementer]

Is it GERALD format?

GERALD															
1	2	3	4	5	6	7	8	9	10	11	12	13	14	15
B2GA005	1	1	95	1341	615	0	1	TAGTAGAGGCCCCCAATGTGGTCCAAGATTCCCTA	ggggggggggggggggggggghggggegggggggg	chr1.fa		3000839	R	35	113
B2GA005	1	1	79	902	907	0	1	GAAAGGGACCACTGTGGGATGGAAGTGGACGTGAG	gdgdggdgbggfggfggceffeY^e[ecVYc]`]`	chr1.fa		3001342	R	26T8	71
B2GA005	1	1	47	804	221	0	1	TAGTGGGAACAAGCTGACAGCTCTGTGTTCTGCTT	ggggggggggggggggggggggggggggggggggg	chr1.fa		3001805	F	35	87

If it is. COuld you please explain the values in columns referring to? so that I could convert into ELAND

[repinementer]

GERALD to BED..Script

But still not sure with F and R definitions I gave..

repine@pc499 ~/MACS-1.3.7.1
$ awk '$13 == "R" {print $11,"\t",$12+35,"\t",$12,"\t",$13,"\t",$1} $13 == "F" {print $11,"\t",$12,"\t",$12+35,"\t",$13,"\t",$1}' CMM027_027_unique_hits.txt |tr 'F' '+' |tr 'R' '-'|tr -d '.fa'