Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • bioinfosm
    Senior Member
    • Jan 2008
    • 483

    Position less than 0 from eland sorted

    I was trying to use findpeaks on eland results using the 'separateelandsortedreads.jar' and it pointed out -ve coordinate mapped reads

    Code:
    R0174892        2       115     1669    54      GGTGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTGGGTTAG      ggggggggWagegggfffffbfbe_ffafeffbfffffffefbeffff`b     chr16.fa        -10     R       3C35NNNNNNNNNNN 7
    Anyone else seen this? What would it mean, as I never expected negative alignment coordinates
    --
    bioinfosm
  • agagne
    Junior Member
    • Jan 2009
    • 7

    #2
    I noticed this recently as well. We were creating bed files, and noticed that some of our alignments started -3. I've only recently noticed this, although I do not have much experience with it. I believe it started with ELAND v2.

    Comment

    • kmcarr
      Senior Member
      • May 2008
      • 1181

      #3
      It is telling you that the alignment of your read is to the minus strand and it overhangs the start of your reference. The position number always indicates the left-most position of the aligned read with respect to the reference coordinate system. This position will be the location of the 3' end of the read if that read matches the minus strand of the reference. Your read has one mismatch (the red G) and 11 bases at the 3' end which have no corresponding reference, represented by the 11 N's in the match description string. (Since the numbering system includes a '0' the 11 unmatched bases start at -10.)

      Code:
      -10        0         10        20        30       39
       |         |         |         |         |        |
             5' - TAACCCTAACCCTAACCCTAACCCTAACCCTAACCGACC
             3' - ATTGGGATTGGGATTGGGATTGGGATTGGGATTGGCTGG
       GATTGGGTGGGATTGGGATTGGGATTGGGATTGGGATTGGGATTGG[COLOR="Red"]G[/COLOR]TGG - 5'

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      34 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      21 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      34 views
      0 reactions
      Last Post SEQadmin2  
      Working...