SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimmomatic problem Romz34 Bioinformatics 1 06-10-2014 02:34 AM
filtering - find-if commands frz Bioinformatics 3 01-23-2014 03:15 PM
Problem with trimmomatic amango Bioinformatics 9 12-29-2013 09:43 AM
Acknowledge/Cite Seqanswers posts and/or community. fjrossello General 0 01-22-2013 06:23 AM
BowTie 1 Commands ? Arupsss Bioinformatics 0 06-21-2012 09:54 AM

Reply
 
Thread Tools
Old 07-18-2014, 10:36 AM   #1
gwilymh
Member
 
Location: Milwaukee

Join Date: Dec 2011
Posts: 56
Default Problem with Trimmomatic: will not acknowledge commands

I am trying to use the program Trimmomatic to removed adapter sequences from an Illumina paired-end read over a computer cluster. While I can get the program to open, it will either not acknowledge the commands I enter or will return an error message. I have tried all kinds of permutations of the input commands without success. Examples of input code and error messages are below

Code:
java -classpath /filepath/Trimmomatic-0.32/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 -trimlog /Results/log.txt \
~/filepath/data_R1.fq ~/filepath/data_R2.fq \
ILLUMINACLIP:/filepath/src/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
Results: (the o/s seems to find and execute the software, but is not feeding in the command; I get the same result if I use the java -jar <path to trimmomatic jar> option for executing Trimmomatic)
TrimmomaticPE [-threads <threads>] [-phred33|-phred64] [-trimlog <trimLogFile>] [-basein <inputBase> | <inputFile1> <inputFile2>] [-baseout <outputBase> | <outputFile1P> <outputFile1U> <outputFile2P> <outputFile2U>] <trimmer1>...

Code: (If I add in the command PE immediately before all other commands, the program executes and can find the fasta file containing the adapter sequences, but then searches for and cannot fund a file called 'PE')
java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
PE -phred33 -trimlog /Results/log.txt \
~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
Results: (Programs rus and finds the fasta file of adapter sequences, but then fails to execute. Why is it looking for a PE file?)
TrimmomaticPE: Started with arguments: PE -phred33 -trimlog /Results/log.txt /filepath/data_R1.fq /filepath/data_R2.fq ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
Multiple cores found: Using 12 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "main" java.io.FileNotFoundException: PE (No such file or directory)
at java.io.FileInputStream.open(Native Method)
at java.io.FileInputStream.<init>(FileInputStream.java:146)
at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:127)
at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:251)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:498)
at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:506)

Last edited by gwilymh; 07-18-2014 at 11:08 AM.
gwilymh is offline   Reply With Quote
Old 07-18-2014, 01:14 PM   #2
blakeoft
Member
 
Location: Connecticut

Join Date: Oct 2013
Posts: 58
Default

Code:
java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
PE -phred33 -trimlog /Results/log.txt \
~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
That PE that's floating around on the second line doesn't need to be there. I think you only put it there when you do the "java -jar" version of running trimmomatic. Can you tell me what happens when you run:

Code:
java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 -trimlog /Results/log.txt \
~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
I'm also not sure about the "true" part at the very end of the code. The documentation doesn't seem to mention any boolean arguments for the ILLUMINACLIP option.

Edit: I misread your original post, so most of what I said will seem stupid. However, I still don't see the "true" tidbit in the documentation. Can you try taking that out?

Edit2: I just found the manual. It doesn't give an example of using the keepBothReads option for ILLUMINACLIP, but it just says specify 'true'. That is, in single quotes. Try changing that around by using single quotes or no quotes instead of double quotes.

Edit3: One last thing! I looked at my scripts and realized that I have output files specified, but you don't. Try adding those too. Sorry for all of the suggestions. Let me know if you get any other errors or if some of my suggestions work. Try

Code:
java -classpath /filepath/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 -trimlog /Results/log.txt \
~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
~/refs/lec12/data_R1_paired.fq ~/refs/lec12/data_R1_unpaired.fq ~/refs/lec12/data_R2_paired.fq ~/refs/lec12/data_R2_unpaired.fq \
ILLUMINACLIP:/filepath/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
and maybe try it with single quotes around true.

Last edited by blakeoft; 07-18-2014 at 01:29 PM.
blakeoft is offline   Reply With Quote
Old 07-18-2014, 09:13 PM   #3
gwilymh
Member
 
Location: Milwaukee

Join Date: Dec 2011
Posts: 56
Default

Thank you blakeoft. I dropped the PE flag and added individual file names for each output file and the program executed properly.

NB: I also tried using the -baseout <outputBase> flag rather than a list of four files, and the program would open but not execute any commands
gwilymh is offline   Reply With Quote
Old 07-19-2014, 02:17 AM   #4
tonybolger
Senior Member
 
Location: berlin

Join Date: Feb 2010
Posts: 154
Default

Quote:
Originally Posted by gwilymh View Post
Thank you blakeoft. I dropped the PE flag and added individual file names for each output file and the program executed properly.

NB: I also tried using the -baseout <outputBase> flag rather than a list of four files, and the program would open but not execute any commands
Glad you have already solved it with blakeoft's help.

As you see for PE mode, 6 files need to be given before the list of trimming steps (unless you use -basein/-baseout which replace 2 / 4 files respectively).

Tony.
tonybolger is offline   Reply With Quote
Reply

Tags
cluster, java, linux, trimmomatic

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:15 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.