Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • jmartin
    Member
    • Dec 2009
    • 78

    Looking for easy way to find RIGHT-most end of alignment in bam

    Is there a way to report the right-most end of an alignment in a bam file? The position given is the left-most part of the alignment, but I need to know where the right-end falls in the reference. I know this can be done with the CIGAR string, but I'm concerned that I don't fully understand how the CIGAR string works with regards to hard & soft clipping, as well as what its reporting with regards to chimeric alignments. I think it might be easy to get this wrong if I'm not careful, and if there is an already existing, robust & convenient tool or method I'd prefer using that.
  • Brian Bushnell
    Super Moderator
    • Jan 2014
    • 2709

    #2
    The easiest way to do this is to map with BBMap, using the "stoptag" flag, which will make it write an extra tag to each line prefixed by YS:i: which gives the read's stop location. I don't currently have a way to do that for existing sam/bam files, but I may incorporate it into reformat.

    This is the code I use:

    Code:
    public static int calcCigarLength(String cigar, boolean includeHardClip){
    	if(cigar==null){return 0;}
    	int len=0;
    	int current=0;
    	for(int i=0; i<cigar.length(); i++){
    		char c=cigar.charAt(i);
    		if(Character.isDigit(c)){
    			current=(current*10)+(c-'0');
    		}else{
    			if(c=='M' || c=='=' || c=='X' || c=='D' || c=='N' || c=='S'){
    				len+=current;
    			}else if (c=='H'){ 
    				if(includeHardClip){len+=current;}
    			}else if(c=='I'){
    				//do nothing
    			}else if(c=='P'){
    				throw new RuntimeException("Unhandled cigar symbol: "+c+"\n"+cigar+"\n");
    				//'P' is currently poorly defined
    			}else{
    				throw new RuntimeException("Unhandled cigar symbol: "+c+"\n"+cigar+"\n");
    			}
    			current=0;
    		}
    	}
    	return len;
    }
    But, as you said, it gets more complicated when you have clipped reads:

    Code:
    public static String makeStopTag(int pos, int seqLength, String cigar, boolean perfect){
    	return "YS:i:"+(pos+((cigar==null || perfect) ? seqLength : -countLeadingClip(cigar, false)+calcCigarLength(cigar, false))-1);
    }
    
    public static int countLeadingClip(String cigar, boolean includeHardClip){
    	if(cigar==null){return 0;}
    	int len=0;
    	int current=0;
    	for(int i=0; i<cigar.length(); i++){
    		char c=cigar.charAt(i);
    		if(Character.isLetter(c) || c=='='){
    			if((includeHardClip && c=='H') || (SUBTRACT_LEADING_SOFT_CLIP && c=='S')){
    				len+=current;
    			}else{
    				break;
    			}
    			current=0;
    		}else{
    			current=(current*10)+(c-'0');
    		}
    	}
    	return len;
    }
    Different aligners calculate pos differently for clipped reads which is why I have flags for counting or not counting hard- and soft-clipped bases.
    Last edited by Brian Bushnell; 03-18-2015, 01:21 PM.

    Comment

    • dariober
      Senior Member
      • May 2010
      • 311

      #3
      Originally posted by jmartin View Post
      Is there a way to report the right-most end of an alignment in a bam file?
      This script below based on python pysam should do it. It adds a YS tag with the end position of the read (mocking Brian's answer).

      Save the script as addReadEndToBam.py (or whatever). It will print to stdout in BAM format.

      Example usage:

      Code:
      addReadEndToBam.py in.bam > out.bam
      
      # Example output alignment:
      M00886:29:000000000-A95CG:1:2103:5504:6001	89	LmjF.01	4	0	34M	=	4	0	CCCTAACCCTAACCTTGACCCTAACCCTATCCCT	FB0AA0AAB1BBBA11GFCGFAB1>B1>1>>>>>	XT:A:R	NM:i:2	SM:i:0	AM:i:0	X0:i:5	X1:i:0	XM:i:2	XO:i:0	XG:i:0	MD:Z:14C14A4	YS:i:37
      This is based on pysam 0.8.1:

      Code:
      #!/usr/bin/env python
      
      import pysam
      import sys
      
      insam= sys.argv[1]
      samfile = pysam.AlignmentFile(insam, "rb")
      outfile = pysam.AlignmentFile("-", "wb", template=samfile)
      
      for aln in samfile:
          ys= aln.reference_end
          if not ys:
              ys= -1
          aln.setTag('YS', ys)
          outfile.write(aln)
      
      samfile.close()
      outfile.close()
      sys.exit()
      Last edited by dariober; 03-20-2015, 06:06 AM. Reason: Use reference_end

      Comment

      Latest Articles

      Collapse

      • mylaser
        Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by mylaser
        Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
        If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
        This guide explains everything you need to know about...
        Today, 01:13 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      17 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      10 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      22 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-02-2026, 11:08 AM
      0 responses
      31 views
      0 reactions
      Last Post SEQadmin2  
      Working...