SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Problems with BWA XA output on kbhit General 1 02-29-2012 02:16 PM
the output of bwa milkingroom Bioinformatics 1 09-21-2011 02:48 PM
Question on BWA output rboettcher Bioinformatics 3 04-18-2011 04:21 AM
bwa output scami Bioinformatics 1 12-22-2010 03:10 AM
output all possible match using bwa mingkunli Bioinformatics 2 09-05-2009 09:06 AM

Reply
 
Thread Tools
Old 06-09-2010, 08:39 PM   #1
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default BWA output interepretation

Hi,
I am finding bit difficulties in understading BWA output format (with indels) and following are my queries.

Code:
GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
:i:3  XO:i:1  XG:i:1  MD:Z:71C0C1
1. XT:A:U means unique hits and XT:A:R means repeat..
2. The above query has the desciptor as 70Match, 1 insertion and 4 matches (75 bp query). If I go to UCSC blat to check this part, first 70 bases matches with the ref (hg18) sequnces and the last GATC is not in that position followed by an insertion in 71st position. Its bit confusing at this stage.
3. How to intrepret
Code:
XO:i:1  XG:i:1
Number of gaps and gap extentions. If my understanding is correct, it opens 1 gap and extended to 1 base. I am trying to understnad the above read results.
3. Sometimes BWA gives XA: (alternate hits) for XT:A:R (multiple hits). Is tehre any threshold for BWA to report these alternate hits. Sometimes I see X0:i:10 ( number of best hits as 10) but alternate hits reports only 3 or 4. Is there any threshold to report alternate hits as I believe BWA doesnot report all alternate hits for every multiple hits.
4. I also want to know about the mismatch tag
Code:
MD:Z:71C0C1
explanation.

I would appreciate very much if someone could explain my above queries. Thanks.
seq_GA is offline   Reply With Quote
Old 06-09-2010, 10:30 PM   #2
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Another example which has both deletions as well as insertion as below:

Code:
GA1_0001:5:1:2203:13069#0   0       chr7    143975167       37      68M1D4M2I1M     *       0       0       TCCATCACTGATCAAGAGTGGGGTGGCAGGTATTAGG
GATAATATTCATTTAGCTTTCTGAGCTTTCTGAGATCG     [email protected]CCCBCACCCCC     XT:A:U  NM:i:4  X0:i:1  X1
:i:0  XM:i:3  XO:i:1  XG:i:1  MD:Z:68^G1G3
How do I intrepret the above result. Thanks.
seq_GA is offline   Reply With Quote
Old 06-13-2010, 06:07 PM   #3
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Can anyone comment on my queries above? Thx.
seq_GA is offline   Reply With Quote
Old 06-13-2010, 08:03 PM   #4
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by seq_GA View Post
Can anyone comment on my queries above? Thx.
Sorry for my own impatience, but the answers can be found in the SAM spec and BWA manual.
nilshomer is offline   Reply With Quote
Old 06-14-2010, 01:23 AM   #5
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

I did go through the manual and still couldn't figure out whether gap opened and extended are real one of any artifact as I am trying to validate the results.

As I mentioned below

Code:
GA1_0001:5:1:2237:4692#0    0       chr8    145553847       37      70M1I4M *       0       0       GGATCTGGGTGGAGCTACCTGTGGTGGTCAAAGAGCTTCCAGAGG
GTGAGTGGGAGGGAGGTGCAGGTGTAGATC     00000;<9:<99+<;9<>;;<AA<A%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%     XT:A:U  NM:i:3  X0:i:1  X1:i:0  XM
:i:3  XO:i:1  XG:i:1  MD:Z:71C0C1
I can't figure out MD:Z:71C0C1 and also, 1 gap is opened and extended one bp. But when I blat the same sequence in UCSC blat, its a perfect match.

And tehre are some example as below whether both insertions and deletion occur in the same read. Is it possible? Thanks.
seq_GA is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:53 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO