automated remote blasting issue

queueing · 04-29-2015, 06:08 AM

Hi everyone,

I'm trying to remotely blast about 70 200-nt sequences using Biopython.
I've been trying for hours to figure out why the following Python script won't work.
I can get it to work for a read file that contains just one fasta using SeqIO.read, but when I try to switch to SeqIO.parse, I don't get anything in the .xml save file that I create.
Any ideas?

As a side note, if anyone knows the option syntax for excluding organisms from the results (as is possible when using the ncbi website, please let me know).

Thanks very much for any help.

Matt

from Bio.Blast import NCBIWWW
from Bio import SeqIO
import tkinter.filedialog as tkfd
in_file=tkfd.askopenfilename()
record = SeqIO.parse(in_file, format="fasta")
out_file = tkfd.asksaveasfilename()
save_file = open(out_file, "w")
for rec in record:
....print(rec)
....result_handle = NCBIWWW.qblast("blastn", "nt", rec.format("fasta"))
....save_file.write(result_handle.read())
....result_handle.close()
else:
....save_file.close()

This is the content of the in_file that I'm using as a test file (the line formatting of my file is set at 80 char, which might have been lost below):
>165613
TAACTGCAGTGTTTTGTGTCGAGCCTTTTTTGTGCCTTTTTTATAAAGGCATAACGTTATATTTAATTGAAGAGTTTGAT
TCTGGCTCAGATTGAACGCTAGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCGCGGGGAGCTTGCTCCCTGGCGGC
GAGTGGCGGACGGGTGAGTAATGCGTAGGAATCTACCTTG
>165875
GGGATCTTCGGACCTCGTGCTATAAGATGAGCCTACGTCGGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACG
ATCCGTAGCTGGTCTGAGAGGACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGG
GAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCC

maubp · 05-04-2015, 02:45 AM

Species restriction can be down with qblast setting entrez_query (or BLAST+ using -remote) and an Entrez [orgn] query, e.g. http://news.open-bio.org/news/2009/0...nfo-biopython/

As to your script, try adding a bit more debugging, e.g.

Code:

    data = result_handle.read()
    print("Got back: %r" % data)
    save_file.write(data)

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
BLAST+ and blasting against the NCBI database	kevluv93	Bioinformatics	4	04-25-2015 01:25 AM
BLASTing masssive protein sequences	dena.dinesh	Introductions	5	02-17-2015 08:04 PM
Blasting contigs against reference database	cyanoevo	Bioinformatics	4	01-27-2015 04:54 AM
Blasting your blastx results against your own database?	noobie	Bioinformatics	1	06-30-2012 02:55 AM
using blast+ for remote blasting	rangel	Bioinformatics	2	03-29-2012 02:30 PM

04-29-2015, 06:08 AM	#1
queueing Junior Member Location: TX Join Date: Mar 2015 Posts: 4	automated remote blasting issue Hi everyone, I'm trying to remotely blast about 70 200-nt sequences using Biopython. I've been trying for hours to figure out why the following Python script won't work. I can get it to work for a read file that contains just one fasta using SeqIO.read, but when I try to switch to SeqIO.parse, I don't get anything in the .xml save file that I create. Any ideas? As a side note, if anyone knows the option syntax for excluding organisms from the results (as is possible when using the ncbi website, please let me know). Thanks very much for any help. Matt from Bio.Blast import NCBIWWW from Bio import SeqIO import tkinter.filedialog as tkfd in_file=tkfd.askopenfilename() record = SeqIO.parse(in_file, format="fasta") out_file = tkfd.asksaveasfilename() save_file = open(out_file, "w") for rec in record: ....print(rec) ....result_handle = NCBIWWW.qblast("blastn", "nt", rec.format("fasta")) ....save_file.write(result_handle.read()) ....result_handle.close() else: ....save_file.close() This is the content of the in_file that I'm using as a test file (the line formatting of my file is set at 80 char, which might have been lost below): >165613 TAACTGCAGTGTTTTGTGTCGAGCCTTTTTTGTGCCTTTTTTATAAAGGCATAACGTTATATTTAATTGAAGAGTTTGAT TCTGGCTCAGATTGAACGCTAGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCGCGGGGAGCTTGCTCCCTGGCGGC GAGTGGCGGACGGGTGAGTAATGCGTAGGAATCTACCTTG >165875 GGGATCTTCGGACCTCGTGCTATAAGATGAGCCTACGTCGGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACG ATCCGTAGCTGGTCTGAGAGGACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGG GAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCC Last edited by queueing; 04-29-2015 at 06:12 AM. Reason: fixed indentation

05-04-2015, 02:45 AM	#2
maubp Peter (Biopython etc) Location: Dundee, Scotland, UK Join Date: Jul 2009 Posts: 1,543	Species restriction can be down with qblast setting entrez_query (or BLAST+ using -remote) and an Entrez [orgn] query, e.g. http://news.open-bio.org/news/2009/0...nfo-biopython/ As to your script, try adding a bit more debugging, e.g. Code: data = result_handle.read() print("Got back: %r" % data) save_file.write(data)