Hi,
Does anybody have idea regarding the general threshold average quality score to determine whether the ILLUMINA raw reads is good or bad quality?
Below is one of my ILLUMINA raw reads in fastq format:
@HWI-EAS001
AACATTCAACGCTGNCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC
+HWI-EAS001
^`Y^aa__^_]\`_B\U][RV`W`^`][``__Z^P[UUZZUUa^Z[^^Z[
The above reads got 50 nucleotide in length.
Is it got any program or script able to calculate the average quality score of above read?
My purpose is hope to calculate the average quality score of each read.
Based on the average quality score of each read, I plan to filter out those "low quality reads" that below threshold of average quality score.
Thanks a lot for any advice.
Does anybody have idea regarding the general threshold average quality score to determine whether the ILLUMINA raw reads is good or bad quality?
Below is one of my ILLUMINA raw reads in fastq format:
@HWI-EAS001
AACATTCAACGCTGNCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC
+HWI-EAS001
^`Y^aa__^_]\`_B\U][RV`W`^`][``__Z^P[UUZZUUa^Z[^^Z[
The above reads got 50 nucleotide in length.
Is it got any program or script able to calculate the average quality score of above read?
My purpose is hope to calculate the average quality score of each read.
Based on the average quality score of each read, I plan to filter out those "low quality reads" that below threshold of average quality score.
Thanks a lot for any advice.


Comment