Problem with mirdeep2

[newfie]

I have a problem with mapper.pl when i input my fasta file containing the reads.

here is the command and the error that i get:

mapper.pl N1_S1.fa -c -p ~/Desktop/bowtiebuild/cod_index -m -s /home/Desktop/cod/collapsed_reads/N1_S1_collapsed.fa -t ~/Desktop/cod/arf_files/N1_S1.arf

First line of FASTA reads file is not in accordance with the fasta format specifications
Please make sure your file is in accordance with the fasta format specifications and does not contain whitespace in IDs or sequences


***** Please check if the option you used (options c) designates the correct format of the supplied reads file N1_S1.fa *****

Here are the first few lines of my FASTA file:

>@NS500451:29:H3T2FBGXX:1:11101:15273:1059 1:N:0:ATCACG
GNGCTACTGGTGAAAT
>@NS500451:29:H3T2FBGXX:1:11101:21477:1064 1:N:0:ATCACG
ANTGGATAGCGCATTGGTA
>@NS500451:29:H3T2FBGXX:1:11101:23355:1065 1:N:0:ATCACG
GNTGTCGTGGCCGAGTGGTTAAGGAAATA

The command that i sued to convert fastq to fasta file is

awk 'NR % 4 == 1 {print ">" $0 } NR % 4 == 2 {print $0}' ~/Desktop/N1_S1_trimmed.fastq > ~/Desktop/N1_S1.fa

Important note: I had this problem when i was using mirdeep2 mapper.pl script in the linux server. But in my own linux machine the mapper.pl generated the collapsed reads and the arf files without any error code. So if there are whitespaces in the identifiers, how come the script doesn't generate any errors when i run in my own linux machine but not in the server?

Do anyone know how to fix this problem?

[JerryZhang]

hi, did you solved your problem?

hi, did you solved your problem?
I've tried several ways to fix this problem but it just doesn't work. i found a site which says that the foramt must be like :
>PAN_123456_x969696
ATACAATCTACTGTCTTTCCT
(https://www.mdc-berlin.de/content/mi...n#File-formats)

my original file is a fastq file and it's first line is like this:
@A00183:416:HLJLJDSXX:4:1101:5267:1000 1:N:0:TGACCAAT+GTTCAGAG

then i use python to convert it like this:
>HUM_3110149961000_x1

but it still doesn't work

[JerryZhang]

i finally figured out how to map this:
1. mapper.pl ./<filename>.fq -e -h -j -m -k<adapter sequence> -l 18 -s <collapsedata.fa> . Then you can get a collapse data.
2. using collapse data to map your reads to the reference genome; or you can just 'quanlifier' it