how to convert general fastq to fastq int format?

[feng]

Is there any one using FASTX? It need fastq int format. Do you know how to convert general fastq into fastq int? Many thanks for any suggestion.

[maubp]

You're not talking about Bill Pearson's tool FASTX, see Pearson et al (1997). Comparison of DNA sequences with protein sequences.

http://www.ncbi.nlm.nih.gov/pubmed/9403055

You probably aren't talking about the FASTX-Toolkit either, since that supports multiple FASTQ variants.

http://hannonlab.cshl.edu/fastx_toolkit/

What are you talking about?

[feng]

I mean the second one. I tried to use Fastx to trim reads in fastq. It seems this program need fastq (int)? It there any more parameter for this?

Thanks.

[maubp]

The FASTX-Toolkit can read standard FASTQ files with ASCII qualities

Could you tell us the command line you are trying to use that fails, and show us the first few reads of your FASTQ file (using the [ code ] and [ /code ] tags in the forum, or the # button on the advanced editor).

[feng]

Hi, I did

$ ./fastq_quality_trimmer -t 20 -l 30 -i sra_data.fastq -o sra_data.fastq.quality.trimmed

fastq_quality_trimmer: Invalid quality score value (char '*' ord 42 quality value -22) on line 12

the fist 12 lines of reads

@SRR001030.1.1 Hela.tar.gz:8:1:328:133.1 length=27
TCGAGATTTCTACAGTCCTTCGATAAC
+SRR001030.1.1 Hela.tar.gz:8:1:328:133.1 length=27
IIIIIIIIIII8IIIIIIIIIIIII4I
@SRR001030.2.1 Hela.tar.gz:8:1:96:66.1 length=27
ATGTACGGTAAATGGAAAAAAAAAAAA
+SRR001030.2.1 Hela.tar.gz:8:1:96:66.1 length=27
IIIIIIIIIIIIIIIIIIIIIIIIIII
@SRR001030.3.1 Hela.tar.gz:8:1:400:280.1 length=27
TCGGATGCCTACTTCTGCTTGAAAACA
+SRR001030.3.1 Hela.tar.gz:8:1:400:280.1 length=27
IIIIIIIIIIIIIII*&IIIIII/III


Any suggestion?

[simonandrews]

Are you using an older version of the toolkit? The files you showed are valid FastQ and use the Sanger encoding method. The FastX download page shows that automatic encoding detection was introduced in v0.0.13 so if you're using a version which is older than that it might be assuming an Illumina encoding.

[maubp]

I think as Simon suggests your (old) version of FASTX-toolkit is probably assuming you have Solexa/Illumina FASTQ (which have a narrow range of allowed characters), but you have Sanger FASTQ. Try the FASTX command line option -Q 33 here.

[feng]

Thanks

I used -Q 33. It works. Many thanks again.

[golharam]

i'm running into the same problem. I just got read off an Illumina GAIIx. Here are the first few lines:

@GEN-SEQ-ANA_0012:2:1:1562:1167#0/1
GAATACGTTCGCGTCACACAGTATCAACGGAAGCGGGTAAATGAAGGCGACACAGGGGATAAGCAGGGTTTCATGAAGTATCTTGGGCACGTGCCAGCGAG
+
A;-A4=B:?0?2?########################################################################################
@GEN-SEQ-ANA_0012:2:1:1626:1169#0/1
GAGGAAGGCGGTTTTGAAGGAGAGGGGAGGCTTTCGGACCAAGGGAAGGAAGGGAGGGTAAGAAAAGGAAAAAGAATTTGTGAGGGAGAAGGGTTTTTATC
+
D@EB:?DD;BF=EEEE>@BB4A;BAA;';;/??88AA################################################################
@GEN-SEQ-ANA_0012:2:1:1959:1166#0/1
GTGAGGGGATGTTCACTAGCTTGCCTACTTCGTCGAAGATCAGCTTGGCCTGGGTATTCGCGGTCCCTGCTGTTTTAAAGTTGGCGCCTGCTGCGTCCGCT
+
@6@)@B@<(?EBDBEBGBDB?B8BE?8,B0:A#####################################################################


When I try to run:

gunzip -dc s_2_reads_passed_filter.fastq.gz | fastx_quality_stats

I get the error

fastx_quality_stats: Invalid quality score value (char '-' ord 45 quality value -19) on line 4

I'm running the latest version:


[golharam@vail input]$ fastx_quality_stats -h
usage: fastx_quality_stats [-h] [-N] [-i INFILE] [-o OUTFILE]
Part of FASTX Toolkit 0.0.13 by A. Gordon ([email protected])

[maubp]

Have you tried the solution discussed above? This tells FASTX to treat the qualities as Sanger FASTQ...

gunzip -dc s_2_reads_passed_filter.fastq.gz | fastx_quality_stats -Q 33

Are you sure your FASTQ files are in the original form from your Illumina GAIIx? Do you know what version of the pipeline it was?

[kmcarr]

The long strings of # are a give away that this FASTQ is encoded in the standard Sanger format (Phred + 33). '#' is ASCII 35; if this was still Illumina format (Phred + 64) these would be 'B' which is the tell tale Illumina Quality Control Indicator.

Do as maubp and others have suggested and add the -Q33 option to your fastx command.

In feng and golharam's defense the -Q parameter to the fastx commands is not documented and does not appear in the help message. It is only discoverable by reading the source code (or the very helpful replies on SeqAnswers). The authors of the fastx toolkit could really help by documenting this option.

[maubp]

In feng and golharam's defense the -Q parameter to the fastx commands is not documented and does not appear in the help message. It is only discoverable by reading the source code (or the very helpful replies on SeqAnswers). The authors of the fastx toolkit could really help by documenting this option.

The -Q option is on http://hannonlab.cshl.edu/fastx_toolkit/ as part of a release announcement, but otherwise I agree with you.

[kmcarr]

The -Q option is on http://hannonlab.cshl.edu/fastx_toolkit/ as part of a release announcement, but otherwise I agree with you.

Thanks for the pointer, I had missed that.

[MQ-BCBB]

Thanks, thanks for the -Q 33 tip. So helpful!

[golharam]

Agreed. The toolkit should really add that as a documented parameter to come up when running from the shell.