Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • katinka03
    Junior Member
    • Aug 2016
    • 3

    Spiking custom primers failed on Miseq runs

    Hi all,

    I would like to know if somebody encountered the same problem as we do at the moment.
    Since Mid February we are no longer able to spike our Fluidigm custom primers (CS1 and CS2) into the Illumina primers (Miseq V2 nano kit 500 cycles).
    We tried now 4 times with different libraries and also with a library that worked before but got no results but PhiX reads.
    When we used the CS1 and CS2 primers as custom primers alone the library was read as usual.
    We tested the primers with our libraries in a normal pcr and they gave perfectly strong signals.

    Thanks
  • thermophile
    Senior Member
    • Apr 2015
    • 243

    #2
    Have you tried new aliquots of the primers? PCR would work but sequencing fail if the primers are mixed up (R1 in R2 well, R2 in R1 well)
    Microbial ecologist, running a sequencing core. I have lots of strong opinions on how to survey communities, pretty sure some are even correct.

    Comment

    • katinka03
      Junior Member
      • Aug 2016
      • 3

      #3
      As usual, in the beginning we were assuming the error to be on our side and we had the same idea: mixed primer directions. But we have used the same primers without Illumina primers as custom read primers and they worked.
      And we spiked the Fluidigm primers as pairs into Illumina primers and this did not work.
      We just wonder if we are the only ones having troubles or if this is something new and others are struggling the same way?

      Comment

      • thermophile
        Senior Member
        • Apr 2015
        • 243

        #4
        you could order the primers that hit phix and put those with your custom primers in the custom primer wells.

        These are the primers that should hit phiX (I haven't tested them but this is what FAS told me to order)

        Illumina.phix.R1
        ACACTCTTTCCCTACACGACGCTCTTCCGATCT

        Illumina.phix.R2
        CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
        Microbial ecologist, running a sequencing core. I have lots of strong opinions on how to survey communities, pretty sure some are even correct.

        Comment

        • katinka03
          Junior Member
          • Aug 2016
          • 3

          #5
          This is a very good idea! Thanks, I will definitely try it.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM
          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-13-2026, 10:26 AM
          0 responses
          26 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          35 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          22 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          34 views
          0 reactions
          Last Post SEQadmin2  
          Working...