soap2 PE results do not match bowtie or novoalign

[axiom7]

Hi,

Here are the two fasta files:


cat 0000002435.1.fa
>0000002435
CTGGCCAACATGGTGAAACC
cat 0000002435.2.fa
>0000002435
ATCATTTAGCTGACTGGAAG

Both novoalign and bowtie show unique and exact hit on chromosome 1, with insert distances in the 300-700 bp range. Strand orientation is fr.

$ grep 0000002435 ../bowtie/250000.out.bt
0000002435/1 + gi|89161185|ref|NC_000001.9|NC_000001 70750 CTGGCCAACATGGTGAAACC IIIIIIIIIIIIIIIIIIII 0
0000002435/2 + gi|89161185|ref|NC_000001.9|NC_000001 71054 CTTCCAGTCAGCTAAATGAT IIIIIIIIIIIIIIIIIIII 0

$ grep 0000002435 ../novo/250000.out.novo
>0000002435 L CTGGCCAACATGGTGAAACC . U 0 11 >gi|89161185|ref|NC_000001.9|NC_000001 70751 F . 71055 R
>0000002435 R ATCATTTAGCTGACTGGAAG . U 0 11 >gi|89161185|ref|NC_000001.9|NC_000001 71055 R . 70751 F

soap2 -a 0000002435.1.fa -b 0000002435.2.fa -D hs_ref_36.3.fa.index -o 0000002435.out -u 0000002435.unmap -M0 -l20 -r0 -m 300 -x 720 -2 0000002435.unp -p8 -v0 2>0000002435.err

$ cat 0000002435.err

Begin Program SOAPaligner/soap2
Wed Jan 26 14:30:46 2011
Reference: hs_ref_36.3.fa.index
Query File a: 0000002435.fr.1.fa
Query File b: 0000002435.fr.2.fa
Output File: 0000002435.out
0000002435.unp
0000002435.unmap
Load Index Table ...
Load Index Table OK
Begin Alignment ...
2 ok 0.01 sec
Total Pairs: 1 PE
Paired: 0 ( 0.00%) PE
Singled: 1 (50.00%) SE
Total Elapsed Time: 11.47
- Load Index Table: 11.40
- Alignment: 0.08

SOAPaligner/soap2 End
Wed Jan 26 14:30:58 2011

Thanks for any ideas.
Susan