SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
minimus2 exit at step 21 doublealice Bioinformatics 1 05-09-2014 07:48 AM
CREST structure variation software exit information Delphine Song Bioinformatics 1 09-29-2011 08:12 PM
fusionseq: PROBLEM: system(rm -rf targets_32087.txt) exit status -1. jaycekoh Bioinformatics 0 09-26-2011 02:35 AM
HTSeq installation: error: command 'c++' failed with exit status 1 Boel Bioinformatics 1 02-23-2011 12:21 AM
Are Solexa GAPipeline v.1.0 ELAND results realignable with new v.1.4 ELAND module? marlei Bioinformatics 1 10-15-2009 06:51 AM

Reply
 
Thread Tools
Old 02-27-2011, 11:26 PM   #1
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default Eland exit code: 2304

Dear all,

I am currently trying to align some reads using Eland (GAPipeline 1.5 via the ...standalone.pl) and I keep getting the following error code, no matter what reference I use. My suspicion lies on the formatting of the reads, but I can't narrow it down. The reads look like this:

@GRCh37:21:1:48129895:206#NNNNNN/1
CTGATAATCAGCAAAATATAAAGTAACAAGAATAC
+GRCh37:21:1:48129895:206#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@GRCh37:21:1:48129895:207#NNNNNN/1
CTCAAAATGTTTTAGCATCTTTCGGTAAAATTCTT
+GRCh37:21:1:48129895:207#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@GRCh37:21:1:48129895:208#NNNNNN/1
AGGAATCCATGCCTATAGGGTAAGATGTGGAAATT
+GRCh37:21:1:48129895:208#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@GRCh37:21:1:48129895:209#NNNNNN/1
GCAAATGCATAGTCTATGGCAGTTACCAGTGTAGC
+GRCh37:21:1:48129895:209#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh


and the output of Eland looks like this:


eland -if ~/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq -it fastq -eg Homo_sapiens.GRCh37.61.dna.chromosome.21.fa
$VAR1 = {
'read-length' => [
-1
],
'pair-params' => '--circular',
'pipeline-dir' => '/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./..',
'input-file' => [
'/home/rboettcher/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq'
],
'seed-length' => [
-1
],
'output-prefix' => './reanalysis',
'base-quality' => 30,
'eland-genome' => 'Homo_sapiens.GRCh37.61.dna.chromosome.21.fa',
'input-type' => 'fastq'
};
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: single input-file specified, will do single read analysis
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: deduced read length of 35 for data in /home/rboettcher/Downloads/Ensembl_Homo_Sapiens_GRCh37.61.dna/Hg_elandReads.fastq
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: Setting seed length for ./reanalysis_eland_extended.txt to 32
/home/rboettcher/aligner/GAPipeline-1.5.0/bin/./ELAND_standalone.pl: About to run /home/rboettcher/aligner/GAPipeline-1.5.0/bin/./../bin/buildSeq.pl --fasta ./reanalysis_qseq.txt > ./reanalysis_eland_query.txt

Argument "" isn't numeric in sprintf at /home/rboettcher/aligner/GAPipeline-1.5.0/lib/perl/Gerald/Common.pm line 381, <GEN0> line 1.


=======================================================================
exit code: 2304
buildSeq using ./reanalysis_qseq.txt did not finish properly!

Exiting...
=======================================================================


Does anyone know how I could proceed / fix this problem?

Regards
rboettcher is offline   Reply With Quote
Old 02-28-2011, 02:25 AM   #2
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default

I've also tried some of the headers that are public (e.g. wikipedia), still no improvement, though I was able to narrow down the error:

the sequence identifier

e.g. @HWUSI-EAS100R:6:73:941:1973#0/1 (source: wikipedia)

is split into the following parts:

machineName, runNumber, lane, tile, x, y, readPairMode, indexBases

Since the program states that the runNumber is missing, I guess that the identifier is not complete, so I will try to find out what the program is expecting (though I am irritated that it has problems with the above identifier that is supposed to work fine). I will update the thread on this matter, so if anybody has the same problem or any experiences, feel free to join the fun.

Regards
rboettcher is offline   Reply With Quote
Old 02-28-2011, 03:28 AM   #3
zee
NGS specialist
 
Location: Malaysia

Join Date: Apr 2008
Posts: 249
Default

Perhaps try another aligner like BWA or novoalign. These programs will accept the FASTQ format in your example.
zee is offline   Reply With Quote
Old 02-28-2011, 05:35 AM   #4
rboettcher
Member
 
Location: Berlin

Join Date: Oct 2010
Posts: 71
Default

Already thought about this, but I somehow managed to find a solution by editing the source code to create a runnumber out of the machinename. So now I just have to add "_somenumber" to the machinename which will then be used as the runnumber, though I have no idea what the number is for in the first place...

As far as I can say the alignment will work fine afterwards (at least for the data that I have used). Still a stupid problem that has cost me a lot of time. If anybody stumbles over the same problem and needs details how to fix it feel free to contact me.

Regards
rboettcher is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO