FREEC GC content file

[jorge]

Hello all,

I'm planning to use FREEC to get CNVs without a control. For that I need to annotate GC content for consecutive 50Kb windows. I see FREEC provides such a file but it's unclear to me what does the fourth column of that file mean. This is how the file looks like

chr window GC_content 'the fourth column'
1 12900000 0.47042 1
1 12950000 0.4453 0.5117

any idea if that fourth column is relevant/mandatory?

Thanks
Jorge

[valeu]

Sorry, I have just seen your question.

The forth column represents mappability.

[juanjingmiao]

Sorry, I have just seen your question.

The forth column represents mappability.

doesn't the fourth column mean percentage of ACGT-letter per window (1-poly(N)%) ?



thanks!

[valeu]

Right, it does. The 5th column must "mappability". But if the 5th column is empty FREEC will use (1-poly(N)% as mappability.

[juanjingmiao]

I used FREEC to get the CNV without a control. The result is :
Chr1 0 101199 3 gain
Chr1 98600 124699 0 loss
Chr1 122100 156299 3 gain

window=2700;
my question is :124699 >122100, this is not a error based on the freec's algorithm. But the breakpoint isn't continuous. I am planning to filter the result, but how to do it ?

Thank you very much!

[valeu]

This can happen if step<window. You may use the first coordinates of regions: in your case, 98600 and 122100.

[juanjingmiao]

This can happen if step<window. You may use the first coordinates of regions: in your case, 98600 and 122100.

Thanks for your help!

if step >window, the step have no effect, doesn't it ?

[valeu]

I hope so
But it is better to set step equal to window or to delete or comment it.

[ndeshpan]

Hi,

I am trying to use Control-FREEC for fungal genomes..

My config file looks like this
======
[general]

chrFiles = individual_Chr_fastaFiles
chrLenFile = res_Cryptococcus_gattii_WM276_ALL_chromosomes_NumericalChrNumbers.fna
coefficientOfVariation = 0.062
ploidy = 1
outputDir = ./
maxThreads = 12
BedGraphOutput = TRUE
minCNAlength = 4
GCcontentProfile = 1

[sample]

mateFile = bwa_S1_vs_WM276_reference.sam
inputFormat = SAM
mateOrientation = FR

[control]

======

using the perl script get_fasta_lengths.pl

I have got my chromosome lengths file

Chr1 1984823
Chr2 2187695
Chr3 1961512
Chr4 2233618
Chr5 1333124
Chr6 1325755
Chr7 1324677
Chr8 1265488
Chr9 989306
Chr10 522727
Chr11 1040760
Chr12 820445
Chr13 705823
Chr14 679007

(It does not have the first column when compared to the sample file in the manual..Anyways I have tried changing that as well..


When I run my script it keeps giving me the error


---------------------------------------------------------
Control-FREEC v7.0 : calling copy number alterations and LOH regions using deep-sequencing data
MT-mode using 12 threads
..Minimal CNA length (in windows) is 4
..Breakpoint threshold for segmentation of copy number profiles is 0.8
..Polynomial degree for "ReadCount ~ GC-content" or "Sample ReadCount ~ Control ReadCount" is 3
..telocenromeric set to 50000
..FREEC is not going to adjust profiles for a possible contamination by normal cells
..Coefficient Of Variation set equal to 0.062
..it will be used to evaluate window size
..Output directory: ./
..Directory with files containing chromosome sequences: /share/bioinfo/nandan/scratch02/DCarter/Stage_2/Cryptococcus_gattii_WM276_reference/for_Control_FreeC_CNV
..Sample file: /share/bioinfo/nandan/scratch02/DCarter/Stage_2/CNV/Control_FreeC_CNV/bwa_S1_vs_WM276_reference.sam
..Sample input format: SAM
..minimal expected GC-content (general parameter "minExpectedGC") was set to 0.35
..maximal expected GC-content (general parameter "maxExpectedGC") was set to 0.55
..File with chromosome lengths: /share/bioinfo/nandan/scratch02/DCarter/Stage_2/CNV/Control_FreeC_CNV/res_Cryptococcus_gattii_WM276_ALL_chromosomes_NumericalChrNumbers.fna
..Using the default minimal mappability value of 0.85
..uniqueMatch = FALSE
..average ploidy set to 1
..break-point type set to 2
..noisyData set to 0
..File /share/bioinfo/nandan/scratch02/DCarter/Stage_2/CNV/Control_FreeC_CNV/res_Cryptococcus_gattii_WM276_ALL_chromosomes_NumericalChrNumbers.fna was read
total genome size: 1.83748e+07
read number: 6076119
coefficientOfVariation: 0.062
evaluated window size: 787
..Starting reading /share/bioinfo/nandan/scratch02/DCarter/Stage_2/CNV/Control_FreeC_CNV/bwa_S1_vs_WM276_reference.sam
PROFILING [tid=47829959698848]: /share/bioinfo/nandan/scratch02/DCarter/Stage_2/CNV/Control_FreeC_CNV/bwa_S1_vs_WM276_reference.sam read in 10 seconds [fillMyHash]
6076119 lines read..
4666119 reads used to compute copy number profile
printing counts into ./bwa_S1_vs_WM276_reference.sam_sample.cpn
..Window size: 787
..using GC-content to normalize copy number profiles
Unable to open file 1
---------------------------------------------------------

When I place my chromosome files in the current directory I get a different error

-----
Control-FREEC v7.0 : calling copy number alterations and LOH regions using deep-sequencing data
MT-mode using 12 threads
..Minimal CNA length (in windows) is 4
..Breakpoint threshold for segmentation of copy number profiles is 0.8
..Polynomial degree for "ReadCount ~ GC-content" or "Sample ReadCount ~ Control ReadCount" is 3
..telocenromeric set to 50000
..FREEC is not going to adjust profiles for a possible contamination by normal cells
..Coefficient Of Variation set equal to 0.062
..it will be used to evaluate window size
..Output directory: ./
..Directory with files containing chromosome sequences: individual_Chr_fastaFiles
..Sample file: bwa_S1_vs_WM276_reference.sam
..Sample input format: SAM
..minimal expected GC-content (general parameter "minExpectedGC") was set to 0.35
..maximal expected GC-content (general parameter "maxExpectedGC") was set to 0.55
..File with chromosome lengths: res_Cryptococcus_gattii_WM276_ALL_chromosomes_NumericalChrNumbers.fna
..Using the default minimal mappability value of 0.85
..uniqueMatch = FALSE
..average ploidy set to 1
..break-point type set to 2
..noisyData set to 0
..File res_Cryptococcus_gattii_WM276_ALL_chromosomes_NumericalChrNumbers.fna was read
total genome size: 1.83748e+07
read number: 6076119
coefficientOfVariation: 0.062
evaluated window size: 787
..Starting reading bwa_S1_vs_WM276_reference.sam
PROFILING [tid=47981594524064]: bwa_S1_vs_WM276_reference.sam read in 10 seconds [fillMyHash]
6076119 lines read..
4666119 reads used to compute copy number profile
printing counts into ./bwa_S1_vs_WM276_reference.sam_sample.cpn
..Window size: 787
..using GC-content to normalize copy number profiles
file 1 is read
Your GC-content file 1 is empty or is in a wrong format

Please use chomosome sequences (option "chrFiles") to recreate it!
----

My individual chromosome files look like this

>Chr1
AAAGTAACCCCCTAACCCCCTAACCCCCTAACCCCCTAACCCCCTAACCCCCTAACCCCCTAACCCCCTA
ACCCCTAACCCCTAAGTTCAAGGCTGTTGTCATGTCCACAGGGGGGCTAGTGAGCAGGGAAACAGCAGAT
GAGATGCGAAGATGGAGGAAGGAGATGAGCCCAGCGGTATTTGAGCGGATGATGAGGAAAATTAGTCTGG
AATTAGTGAGGGCAAGAGCTAGGACGTTTGCGATGTGAGGAGGAAGGAGAGGGTAAAGAAGTGACTGTAG
ATATAGAAATAAAAACAGAAAATCATTAAATACAAAAGCTCGACACAAAACCAATAAACTAGAAAGCTTT
TATGTATCCTCTTTCACCCTTCCAGTAGATTAAATGCATTGGCCCCAAACCAGCTTAGTCTTCTCACAAA
GCTCAGTCTCGCTGAACTCGTGCTCAAAACACAGGATATCCCTTTAAAACTGCAGACAAACCACCGAGGA
CCACCAAACTATAGTAGCATCACGTGCCTCCGACTTCTATGAGGTTAAGGCATCGCTACGAAAAATGTCT
TTTTCTTTACGATGACTCCGATCTCCTGCTCCGCTTCTTTGTGGTCTCAGGCACCGTACTCTTCTCCCCT



It could be a small thing I am missing ,, not sure. Can anyone help?

regards,

Nandan

[valeu]

Hi,

I am trying to use Control-FREEC for fungal genomes..

My config file looks like this
======
[general]

GCcontentProfile = 1



When I run my script it keeps giving me the error


..using GC-content to normalize copy number profiles
Unable to open file 1
---------------------------------------------------------

When I place my chromosome files in the current directory I get a different error


..using GC-content to normalize copy number profiles
file 1 is read
Your GC-content file 1 is empty or is in a wrong format

Please use chomosome sequences (option "chrFiles") to recreate it!

Nandan

GCcontentProfile should be a file with GC-content per window (and not a value TRUE or FALSE). Just remove this line to create the GC-content profile using fasta files of your chromosomes.

Check http://bioinfo-out.curie.fr/projects...al.html#CONFIG