I'm going to bump this thread to mention to mention that BAMs merged with samtools merge will not produce output unless the -c flag is provided to combine @RG headers with colliding IDs - if appropriate.
Without the -c flag, samtools merge will create additional @RG IDs in the read mapping that may not be in the header, especially if a header is provided with the -h flag.
Unconfigured Ad
Collapse
X
-
Hi slink,
if your mappings are already finished you can add the read group with Picard as well. For breakdancer ist is also enough, if the RG is mentioned in the header. So you can simply modify the header manually.
Best regards
Robby
Leave a comment:
-
-
Leave a comment:
-
-
Hi all,
I'm having a similar problem and I think it might be due to the way I'm originally aligning the file. I'm aligning with bowtie in the SAM format (-S), but the header is @PG and there are no @RG tags for the reads.
How are you aligning your files to get the Read Group Id?
Thanks,
Sara
Leave a comment:
-
-
Dear zhongj,
thanks for your answer. My problem is already solved.
I used the following commandI received the message mentioned before, but that is not an error message. For the first computations it is enough to use a specified amount of reads. The output of that script should look like:perl bam2cfg.pl -g -h sample.bam > sample.cfg
After that I proceeded with breakdancer-max1.2 and it worked. At least I received an output and try to analyze and understand that at present.readgroup:xxx platform:ILLUMINA map:/path/to/bam/sample.bam readlen:xxx lib:xxx num:xxx lower:xxx upper:xxx mean:xxx std:xxx SWnormality:-xxx flag:0(xx.xx%)1(x.xx%)18(xx.xx%)2(x.xx%)32(x.xx%)4(x.xx%)8(x.xx%)30001 exe:samtools view
Best regards
Robby
Leave a comment:
-
-
Hello,
did you solve the problem? If yes, could you share the solution, please? I have no outpufile as well and I don't know, what is wrong with my bam file.
My header looks like the following lines:
@HD VN:1.0 SO:coordinate
@SQ SN:chr1 LN:249250621
....
@SQ SN:chr22 LN:51304566
@SQ SN:chrX LN:155270560
@SQ SN:chrY LN:59373566
@SQ SN:chrM LN:16571
@RG ID:sample CN:xxx PL:ILLUMINA SM:sample LB:sample PI:50
@PG ID:bwa PN:bwa VN:0.5.9-r16
My reads look like
The output is of bam2cfg_2.pl is:readid1 1123 chrM 1 60 101M = 160 260 GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGG @@@FDFADFADFD>FH@FHEIIIIIIIFGGGGII
C@6BGHGCEEHIIIGIIH(B7@CHGGCCEE<CE/909)2:4>8<>B9>@>3@@4>@BB>@?9<9@ RG:Z:sample XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:101
HWI-ST758_0058:1:1104:17925:175341#CTTGTA 1187
chrM 1 60 101M = 237 337 GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGG @@??DF?D;=<DBG<?F9E:AFG>HF99E9CCF=@6)?0D>D9??BDGDFFB<F8=CGCFGA@HIH3=:/5;BB<A4@8&055933>@>+39&059@@055 RG:Z:sample XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:101
HWI-ST758_0058:1:1105:15315:81776#CTTGTA 1123
Could anyone help me?Processing bam:test.bam
Closing BAM file
Send TERM signal for 5164
samtools pid process 5164 is still there...
invoking kill -9 on 5164 ...
Closing samtools process : 5164
Best regards
Robby
Leave a comment:
-
-
You need to add the @RG entry to the header and then add an RG field pointing to that @RG entry for each alignment record. See the SAM/BAM specification for more information.
Leave a comment:
-
-
Yes, you are right! But how can I fix my BAM file to adapt bam2cfg.pl? Manually add "@RG" ahead every alignment line? Like the following
@R 1.2k GHWI-ST833:6:4:18265:54791#0 145 scaffold00001 207 0 50M scaffold00079 243097 0 TTTACTAAAACCGATTGGNCCCGGACAATATTTCGATGTGGGCCGGCCCT ggggggfggg\[]]][K]B[e`gggggfggWgggggegcggggggggggg XT:A:R NM:i:1 SM:i:0 AM:i:0 X0:i:2 X1:i:2 XM:i:1 XO:i:0 XG:i:0 MD:Z:18T31 XA:Z:scaffold00100,+12080,50M,1;scaffold00042,-1233,50M,2;scaffold00007,-133793,50M,2;
or How to fix bam2cfg.pl to adapt my BAM file?
Looking forward for your reply!
Thanks.
Originally posted by ddgenome View PostIt really seems your BAM is not well-formed (at least for sequence analysis). Looking closer at the alignment record from the example BAM you provided, the read does not have an RG tag. So you are creating an RG record, but then no reads are associated with it.Last edited by zhongj; 12-16-2011, 12:52 AM.
Leave a comment:
-
-
It really seems your BAM is not well-formed (at least for sequence analysis). Looking closer at the alignment record from the example BAM you provided, the read does not have an RG tag. So you are creating an RG record, but then no reads are associated with it.
Leave a comment:
-
-
It still do not work. My Bam header do contain a @PG entry. Any one could help me? BreakDancer is too annoying...
Originally posted by ddgenome View PostYour code does not seem quite right. Are you sure the conditional tests on @PG (program)? The standard version of bam2cfg.pl tests on @RG (read group). Does your BAM header contain a @PG entry? If not, your changes are not getting executed because they are inside an if block that never evaluates to true. Can you just add an RG group to your BAM using samtools reheader? Otherwise, you should probably just set the $libs{$lib}, $RGlib{$id}, and $RGplatform{$id} before you open the BAM.
Leave a comment:
-
-
Your code does not seem quite right. Are you sure the conditional tests on @PG (program)? The standard version of bam2cfg.pl tests on @RG (read group). Does your BAM header contain a @PG entry? If not, your changes are not getting executed because they are inside an if block that never evaluates to true. Can you just add an RG group to your BAM using samtools reheader? Otherwise, you should probably just set the $libs{$lib}, $RGlib{$id}, and $RGplatform{$id} before you open the BAM.
Leave a comment:
-
-
BreakDancer empty cfg (no output from bam2cfg)
Hi, everyone, I had spent days to do trouble-shooting on bam2cfg.pl,
breakdancer-1.1_2011_02_21.zip. I had tried some ways to figure out the problem, but without any success. Owing to only one lib I have, I changed the header code of bam2cfg.pl,
Edited code:
open(BAM,"samtools view -h $fbam |") || die "unable to open $fbam\n";
while(<BAM>){
chomp;
if(/^\@PG/){ #getting RG=>LIB mapping from the bam header
my ($id)="bwa";
my ($lib)="1.2k";
my ($platform)="Illumina";
my ($sample)="88LN";
my ($insertsize)="1200";
#if(defined $insertsize && $insertsize>0){
#$lib=$sample . '_'. $lib;
$libs{$lib}=1;
$RGlib{$id}=$lib;
$RGplatform{$id}=$platform;
#}
}
this is the sorted bam file I have:
@SQ SN:scaffold00001 LN:10500
@SQ SN:scaffold00002 LN:2281
@SQ SN:scaffold00003 LN:27085
@SQ SN:scaffold00004 LN:12161
@SQ SN:scaffold00005 LN:2206
.
.
.
@PG ID:bwa PN:bwa VN:0.5.9-r16
.
.
.
HWI-ST833:6:4:18265:54791#0 145 scaffold00001 207 0 50M scaffold00079 243097 0 TTTACTAAAACCGATTGGNCCCGGACAATATTTCGATGTGGGCCGGCCCT ggggggfggg\[]]][K]B[e`gggggfggWgggggegcggggggggggg XT:A:R NM:i:1 SM:i:0 AM:i:0 X0:i:2 X1:i:2 XM:i:1 XO:i:0 XG:i:0 MD:Z:18T31 XA:Z:scaffold00100,+12080,50M,1;scaffold00042,-1233,50M,2;scaffold00007,-133793,50M,2;
.
.
.
"perl bam2cfg.pl *bam > jun.cfg"
At last: samtaols and perl run successfully, but no output from bam2cfg .
Could anyone help me?
Thanks in advance!
Best
JunLast edited by zhongj; 12-14-2011, 01:50 AM.
Latest Articles
Collapse
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
-
by SEQadmin2
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...-
Channel: Articles
07-08-2026, 05:17 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Yesterday, 11:41 AM
|
0 responses
10 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 11:41 AM
|
||
|
Started by SEQadmin2, 07-20-2026, 11:10 AM
|
0 responses
23 views
0 reactions
|
Last Post
by SEQadmin2
07-20-2026, 11:10 AM
|
||
|
Started by SEQadmin2, 07-13-2026, 10:26 AM
|
0 responses
37 views
0 reactions
|
Last Post
by SEQadmin2
07-13-2026, 10:26 AM
|
||
|
Started by SEQadmin2, 07-09-2026, 10:04 AM
|
0 responses
46 views
0 reactions
|
Last Post
by SEQadmin2
07-09-2026, 10:04 AM
|
Leave a comment: