mirdeep2 check mirna folding

[RTK45]

Hi,

i have donwloaded mirdeep2 and i would like to know if my reads (wich are matures sequences) are able to make folding, then i will consider them like microRNA.

Do you know the command line wich enables this kind of test ?

[RTK45]

In fact,

i try to use the script excise_precursors.pl:

excise_precursors.pl genome.fa my_reads.arf -b

and i obtain this messsage :

Problem with read format
Problem with read format
Problem with read format
Problem with read format
Problem with read format
...

However my reads are as in the documentation page :

.arf
The arf format is a proprietary file format generated and processed by miRDeep2. It contains information of reads mapped to a reference genome. Each line in such a file contains 13 columns. Example line:

PAN_123456_x969696 21 1 21 ATACAATCTACTGTCTTTCCT chr22 21 46508682 46508702 ATACAATCTACTGTCTTTCCT + 1 mmmmmmmmmmmmmmmmmmmmm

Any ideas ?