[tonybolger]

I actually like fastx_clipper. Seem less convoluted than Trimmomatic. But it does require re-syncing of PE reads after running.

Does not compute - how is this 'less convoluted than trimmomatic'? Avoiding this sort of thing was one big reason why i wrote trimmomatic. The other being the combination of many different trimming steps into a one-pass tool, rather than making a million and one intermediate files.

Incidentally, why do you consider trimmomatic convoluted?

Sure, it could do with a nice script to hide the 'javaisms' behind (which has been on my todo list forever), and making the adapter fasta is a PITA for new users (which i can help with), but apart from that, i open to any suggestions you might have for improving it.

[pmiguel]

Does not compute - how is this 'less convoluted than trimmomatic'? Avoiding this sort of thing was one big reason why i wrote trimmomatic. The other being the combination of many different trimming steps into a one-pass tool, rather than making a million and one intermediate files.

Incidentally, why do you consider trimmomatic convoluted?

Sure, it could do with a nice script to hide the 'javaisms' behind (which has been on my todo list forever), and making the adapter fasta is a PITA for new users (which i can help with), but apart from that, i open to any suggestions you might have for improving it.

trimmomatic is doing a bunch of stuff under the hood while fastx_clipper is doing one thing. Most of the time I like simpler tools better. So I think I would use fastx_clipper, no matter what. But I will admit that is a matter of taste and lots of others will prefer a tool that subsumes a greater segment of the pipeline. No offense intended...

Since you are offering, I would like it better if you explained what the deal is with that "palindromic" trimming thing. I just am not getting when that should be used and when the simple trimming would be best.


--
Phillip

[MWN]

that would be truly fantasitc

I didnt use the standard illumina adapters since the library prep is from Haloplex and there is some additional 'stuff' to trim off that is different at each end.

Alos, I might have missed it, but how do I get it to generate a log file?
i tried piping the output to a file but only got this:

Length cut-off for read 1: 35 bp (default)
Length cut-off for read 2: 35 bp (default)
Writing final adapter and quality trimmed output to /home/ngsuser/NGS/DATA/raw_data/3_demultiplexed/s_G1_L001_R1.fastq_split_2_trimmed.fq

Length cut-off for read 1: 35 bp (default)
Length cut-off for read 2: 35 bp (default)
Writing final adapter and quality trimmed output to /home/ngsuser/NGS/DATA/raw_data/3_demultiplexed/s_G1_L001_R2.fastq_split_2_trimmed.fq


I'm running trim_galore as follows:

trim_galore --paired --retain_unpaired --quality 15 --fastqc_args "--outdir $current_directory/logs/CutAdapt/" -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT ${input_fastq_path}/${input_fastq_R1} ${input_fastq_path}/${input_fastq_R2} > $current_directory/logs/CutAdapt/$sample_name'_R1_log'

Many thanks

What additional adapter sequence Haloplex added? Thanks,

[d1antho]

You could also use fastqMCF tool (http://code.google.com/p/ea-utils/wiki/FastqMcf). fastq-mcf sequence quality filter, clipping and processor.

I've used it and its pretty easy to use and maintains the order or PE data, it also removes both mates from the fastq files when one fails the quality check

[jordi]

What additional adapter sequence Haloplex added? Thanks,

As far as I know using HaloPlex there are no 5' adapters. Reagrding 3' adapters there are a pair of seqeunces to be considered in the trimming step prior mapping the sequences:
>1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

Could anyone says if I'm right??

[htetre]

Hello I have a python script to sync my paired end reads after quality filtering and am running into errors since I have Python 3 on my computer. Would someone mind looking at the problem area (pasted below) and the warning (pasted underneath script) and tell me how I correct the script for Python 3?

SCRIPT IDENTIFIED WITH ERROR:
except IOError as err (_, message):
sys.stderr.write('Error: %s\n' % message)
sys.exit(1)

ERROR MESSAGE:
File "sync_pe_reads.py", line 109
except IOError as err (_, message):
^
SyntaxError: invalid syntax


Thank you for your help

[CHObot]

I second the vote for timmomatic. Once you get the hang of how to make the adapter seqeunce file, it is really easy to use, fast and takes care of all of the paired end info stuff. A very powerful tool.

[htetre]

I second the vote for timmomatic. Once you get the hang of how to make the adapter seqeunce file, it is really easy to use, fast and takes care of all of the paired end info stuff. A very powerful tool.

Get the hang of how to make the adapter sequence file? I wonder if I did that wrong. Do you just make a fasta file with your adapters, ie barcode sequence with a header? Or is there something I missed and I am trimming incorrectly?

[CHObot]

Get the hang of how to make the adapter sequence file? I wonder if I did that wrong. Do you just make a fasta file with your adapters, ie barcode sequence with a header? Or is there something I missed and I am trimming incorrectly?

I would suggest carefully reading the manual here:

http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.30.pdf

There are some powerful options like using palindrome mode for trimming readthrough and so forth that are explained pretty well here. It took me a while for it to sink in but then again I am a relative newbie. And the manual explained some options I didn;t even know existed.

[dpryan]

Hello I have a python script to sync my paired end reads after quality filtering and am running into errors since I have Python 3 on my computer. Would someone mind looking at the problem area (pasted below) and the warning (pasted underneath script) and tell me how I correct the script for Python 3?

SCRIPT IDENTIFIED WITH ERROR:
except IOError as err (_, message):
sys.stderr.write('Error: %s\n' % message)
sys.exit(1)

ERROR MESSAGE:
File "sync_pe_reads.py", line 109
except IOError as err (_, message):
^
SyntaxError: invalid syntax

I think it should just be:

try:
    ...
except IOError as err:
    sys.stderr.write("'Error: %s\n' % message)
    sys.exit(1)

Also, use a different trimmer as you should never need to resync reads.

BTW, next time, use the "["CODE] (removing the quotes) tags, since it otherwise looks like the syntax error is at the beginning of the line.