SOAP denovo assembly results

[bioinfosm]

Hi,

I was able to assemble more than 100 million reads to contigs using SOAP. That was cool, as all other tools ran into memory issues..

However, I wish to understand some of the properties of contigs, like
- how many reads were actually used in the assembly
- what kind of depth of coverage do the contigs have from overlapping reads
- other properties to determine how confident I could be of the contigs

any pointers... and any help with extracting info from the soap assembly results (except the contig sequences I already have)

[henry]

Hi,

I was able to assemble more than 100 million reads to contigs using SOAP. That was cool, as all other tools ran into memory issues..

However, I wish to understand some of the properties of contigs, like
- how many reads were actually used in the assembly
- what kind of depth of coverage do the contigs have from overlapping reads
- other properties to determine how confident I could be of the contigs

any pointers... and any help with extracting info from the soap assembly results (except the contig sequences I already have)

This is a good question. I also wanna know. could anyone kindly help us?
Btw, how much time did it take to denovo assemble more than 100 million reads into contigs?

Best

Jing

[lcollado]

How much RAM did you need with SOAP? I'm curious ^^

[bioinfosm]

Less than 100Gb RAM, I did not track it (as long as it was not crashing, I was happy)
Time, it took less than a day to get done with its various steps. A lot of contigs are length 24 and definitely not useful.
>1 length 24 cvg_0_tip_0
AAAAAAAAAAAAAAAAAAAAAAAA
>3 length 24 cvg_0_tip_0
AAAAAAAAAAAAAAAAAAAAAAAC
...
>347 length 65 cvg_10_tip_0
TTCAGTAATAACGGCAGACTAATCACCTCAGAAAACACAAAGCACAAGCTTGTGCTTGTCACTTC


Looking for some documentation to understand this better...

[node]

Hi

A better way to ask for help about SOAPdenovo , is join to SOAP's mailing list !

And here is the SOAP site: http://soap.genomics.org.cn . You can submit your email on the home page .

PS: SOAP use Google group as it's mailing list .

[rubi]

Hi,

Can anyone refer me to good documentation on quality assessment of soap denovo assembly (e.g., n50 values, how to compute coverage, and what the output files mean, etc...)

Thanks

[[email protected]]

Denovo assembly pipeline

I'm curious if there is a pipeline available for Soap De novo assembly. Is there a requirement for the number of genomes required for Denovo assembly?

[narain]

Dear Members

I am doing de-novo assembly of human genome from fastq data files. I get contigs as well as scaffolds from tools that I use. I know that scaffolds are a combination of contigs with estimated gaps in between them. Does this mean that downstream analysis when comparing it to another genome such as the reference should be done with contigs more reliably than with scaffolds ?

Aby

[darren.cullerne]

bioinfosm:

However, I wish to understand some of the properties of contigs, like
- how many reads were actually used in the assembly
- what kind of depth of coverage do the contigs have from overlapping reads
- other properties to determine how confident I could be of the contigs

The way our "lab" (aka office) has looked at the number of reads used in an assembly is to take the raw reads and back align them against the newly created denovo contigs. It should give a pretty good indication. We use Kanga for our back alignments. Damned quick and efficient:

http://code.google.com/p/biokanga/

[sagarutturkar]

I am confused about contig numbers reported by Soap.I was trying to
run SoapDenovo for small microbial genomes (Size varies from 5-10MB).

However, the number of contigs reported in .contig files is very high
(always in thousands) whereas other assemblers giving me contigs less
than 500. But Soap-Scaffolding output was better than other
assemblers.

I am not sure, if I am looking at some intermediate contig file OR
contig number is always high in Soap? From my experience contig and
Scaffolds numbers differ by few 100s only (at least for small microbial genomes). There is no drastic change, but in Soap contigs were in 2000-3000 range while scaffolds were in 200-500 range. Please explain.