Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • prs321
    Member
    • Jun 2013
    • 96

    #1

    How to use Scythe in order to cut adapter sequences?

    I read the manual and it says how you need a fasta file as an input?

    I am looking at the overrepresented sequences in the FASTQC files of my paired end reads, but I don't see an option in Scythe in order to remove them this way.

    How can I do this?
  • atcghelix
    Member
    • Jul 2013
    • 74

    #2
    You need a fasta file of your adapter sequences, which will depend on the library preps you did, as well as any barcodes you added. What chemistry did you use and what was the sequencing platform?

    Also, you will most likely have to change the quality scoring to match your fastq files (for instance, with '-q 33' if you used the newest Illumina pipeline).

    Comment

    • prs321
      Member
      • Jun 2013
      • 96

      #3
      I'm a biologist/computer scientist, not a chemist.

      The sequencing platform was Sanger.

      The minimum quality score should be 20, but i don't know how to specify this from the program. The minimum base pair length should be 50 and i dont know how to specify this either.

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #4
        There are no adapters in Sanger sequencing for you to trim (they're used in next-gen sequencing).

        BTW, have a look at Lucy, which I recall being commonly used to quality trim Sanger sequencing (It's been a few years since I've done Sanger sequencing).
        Last edited by dpryan; 10-08-2013, 12:38 PM. Reason: Add link to Lucy

        Comment

        • atcghelix
          Member
          • Jul 2013
          • 74

          #5
          I agree with Devon that Lucy would work for what you want (I think it uses Phred scores, so you'd need those).

          Like Devon said, you don't have adapters in Sanger sequencing. You might have primer sequences on the very ends of your sequences that you can trim, but those would be specific to the region you're amplifying.

          You also wouldn't use scythe to do hard quality-score trimming even on next-gen data, it's just for identifying adapter contamination on the ends of reads where base-calling quality is typically low. You'd instead use something like sickle or Trimmomatic. If you have phred scores on your Sanger sequences then I guess sickle might work on those too.

          Comment

          • rturba
            Junior Member
            • Jun 2017
            • 1

            #6
            How to put together an adapter file for Scythe?

            I still would like some information on this if possible. I'm new on sequence analysis and I'm having trouble to figure out how to put together the adapters file.

            I have a barcode file, and this is what I have found online:

            adaptors.fasta: Provide contaminant sequences as a fasta-formatted file.
            See ´/usr/share/doc/scythe/illumina_adaptors.fa´.
            N.B.: Index/Barcode sequences should be substituted for Ns in the example adaptor file.

            And this is what they say in the READ.me:

            In the case of the original Solexa/Illumina adapter sequences, we've seen barcodes "upstream" of forward reads (in which case the reverse complement of the barcode will appear before the adapter sequence at the 3'-end of reverse reads - replacing the [NNNNNN]). We've also seen barcodes upstream of reverse reads (in which case the reverse complement of the barcode will appear before the adapter sequence at the 3'-end of forward reads - replacing the [MMMMMM]). Your definition of the barcode may be someone else's reverse-complemented barcode, and the barcode may or may not be 6 bases.

            But where do the NNNs and MMMs go in the sequences? They don't show an example. They only give you a illumina.adapters.fa file like this:

            >multiplexing-forward
            GATCGGAAGAGCACACGTCT
            >solexa-forward
            AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
            >truseq-forward-contam
            AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
            >truseq-reverse-contam
            AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
            >nextera-forward-read-contam
            CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
            >nextera-reverse-read-contam
            CTGTCTCTTATACACATCTGACGCTGCCGACGA
            >solexa-reverse
            AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

            Thank you for the time to reply to this.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              New Genomics Technologies Take Aim at Long-Standing Limits
              by SEQadmin2


              Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

              We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
              ...
              Yesterday, 10:25 AM
            • SEQadmin2
              How Immunogenomics Decodes Immunity’s Genetic Blueprint
              by SEQadmin2




              The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

              This convergence of genetics, immunology, and computation...
              09-01-2026, 05:41 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Today, 09:51 AM
            0 responses
            7 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 09-25-2026, 09:06 AM
            0 responses
            31 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 09-23-2026, 11:05 AM
            0 responses
            26 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 09-18-2026, 11:37 AM
            1 response
            47 views
            0 reactions
            Last Post pekgio
            by pekgio
             
            Working...