Tweet
I'd appreciate if anybody could let me know any easy ways to convert capital to small letters of exon sequences in a sam/bam files or point to any relevant threads.
Thanks in advance.
Aki
Thanks in advance.
Aki
-
-
even if you could do this, I'm afraid tools like samtools would convert the bases to uppercase.
here is a test with samtools 1.18, everything is converted to uppercase.
Code:@SQ SN:ref LN:45 @SQ SN:ref2 LN:40 r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * r003 16 ref 29 30 6H5M * 0 0 TAGGC * r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
and now piped into a simple samtools view:
Code:~$ ~/samtools-0.1.18/samtools view -S ~/samtools-0.1.18/examples/toy.sam [samopen] SAM header is present: 2 sequences. r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * r003 16 ref 29 30 6H5M * 0 0 TAGGC * r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ???????????????????? x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
-
BAM files have no concept of case, they simply encode the base call as a 4 bit integer. While you could do this in a SAM file, it might break a lot of down-stream applications.Comment
-
Many organizations study rare diseases, but few have a mission as impactful as Rady Children’s Institute for Genomic Medicine (RCIGM). “We are all about changing outcomes for children,” explained Dr. Stephen Kingsmore, President and CEO of the group. The institute’s initial goal was to provide rapid diagnoses for critically ill children and shorten their diagnostic odyssey, a term used to describe the long and arduous process it takes patients to obtain an accurate...12-16-2024, 07:57 AM -
Innovations in next-generation sequencing technologies and techniques are driving more precise and comprehensive exploration of complex biological systems. Current advancements include improved accessibility for long-read sequencing and significant progress in single-cell and 3D genomics. This article explores some of the most impactful developments in the field over the past year.
Long-Read Sequencing
Long-read sequencing has seen remarkable advancements,...12-02-2024, 01:49 PM
Comment