I'd appreciate if anybody could let me know any easy ways to convert capital to small letters of exon sequences in a sam/bam files or point to any relevant threads.
Thanks in advance.
Aki
Thanks in advance.
Aki
-
-
even if you could do this, I'm afraid tools like samtools would convert the bases to uppercase.
here is a test with samtools 1.18, everything is converted to uppercase.
Code:@SQ SN:ref LN:45 @SQ SN:ref2 LN:40 r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * r003 16 ref 29 30 6H5M * 0 0 TAGGC * r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
and now piped into a simple samtools view:
Code:~$ ~/samtools-0.1.18/samtools view -S ~/samtools-0.1.18/examples/toy.sam [samopen] SAM header is present: 2 sequences. r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * r003 0 ref 9 30 5H6M * 0 0 AGCTAA * r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * r003 16 ref 29 30 6H5M * 0 0 TAGGC * r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ???????????????????? x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
-
BAM files have no concept of case, they simply encode the base call as a 4 bit integer. While you could do this in a SAM file, it might break a lot of down-stream applications.Comment
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment