how to install cutadapt in ubuntu 12.04

[paa6]

I have tried everything.......from installing python2.7 to python 3.3 and then installing cython as well.....but I get error everytime while installing cutadapt...I am working on root as well..

.Error compiling Cython file:
------------------------------------------------------------
...
# kate: syntax Python;
# cython: profile=False
from __future__ import print_function, division, absolute_import
^
------------------------------------------------------------

cutadapt/_seqio.pyx:3:49: future feature absolute_import is not defined
cutadapt/_seqio.c:1:2: error: #error Do not use this file, it is the result of a failed Cython compilation.
error: Setup script exited with error: command 'gcc' failed with exit status 1
root@ubuntu:~/.local/share#

I don't understand why it shows that error compiling cython file...
I am trying to install cutadapt because I want to remove adapter sequence from my illumina reads...
friends please suggest something

[Brian Bushnell]

I suggest BBDuk.

Just download and unzip. It requires Java.

For paired files, the command would be:

bbduk.sh -Xmx1g in1=reads1.fq in2=reads2.fq out1=clean1.fq out2=clean2.fq ref=adapters.fa ktrim=r k=28 mink=12

"ktrim=r" will locate adapters and trim them, removing the kmer and all bases to its right. "k=28 mink=12" will use 28-mers for the bulk of the read, and drop as low as 12-mers for adapters on the far right end of the read (which may have fewer than k bases in the read).

You can optionally specify "hdist=X" (where X is a number 1-3) to allow that many substitution errors in the kmer.

[paa6]

thanks for quick reply , I will try this one.. but I am using single end Illumina reads....and my adapters are default ones from trueseq. which means I have 13 bases AGATCGGAAGAGC.
please tell me codes for single end..
thanks in advance..

[Brian Bushnell]

For single-ended data:

bbduk.sh in=reads.fq out=clean.fq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20

Truseq adapters are actually much longer than 13 bases. I don't have them on my current computer but if you want increased specificity you should use a file with the whole adapter; I'll post it tomorrow, unless someone else does first. Though 13 bases should give you something like a 1/67 million false positive rate, so it's probably fine. "minlen=20" is optional; it tells it to discard reads that are shorter than 20bp after trimming.

[paa6]

I know what u meant by trueseq. adapters and I know they r pretty long. Actually in my fastqc report I got error in Sequence duplication level. And I got warning in overrepresented sequences....
I got this sequence in report
CCTTCAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGA

but while analyzing my kmer content report (I got warning here as well) I didnt get any kmer which were matching to overrepresented sequence and they are...
1. CTTCA
2.GAAGA
3.TGCCG
4.CAGCA
5.AGCAG
6.TCAGC
I got many but writing these ones because they r mentioned in the graph.
My per base sequence quality and per base GC content report is good so I came on conclusion that there is nothing wrong with my sequence but might be I got adapter contamination. A part of trueseq. adapter those 13 bases I can see in my overrepresented sequence and i.e. why I have decided to trim only these 13 bases.

[GenoMax]

@paa6: Option suggested by Brian is pretty straight forward and will not need any software installation.

If you are having problems installing cutadapt then give trimmomatic a try: http://www.usadellab.org/cms/?page=trimmomatic. Trimmomatic includes the adapter sequence files you need to trim adapters.

[paa6]

@paa6: Option suggested by Brian is pretty straight forward and will not need any software installation.

If you are having problems installing cutadapt then give trimmomatic a try: http://www.usadellab.org/cms/?page=trimmomatic. Trimmomatic includes the adapter sequence files you need to trim adapters.

Actually I have tried brian idea but the problem is nothing is mentioned in site how to install it neither he mentioned it so I am thinking to give try to trimmomatic...

[GenoMax]

Actually I have tried brian idea but the problem is nothing is mentioned in site how to install it neither he mentioned it so I am thinking to give try to trimmomatic...

There is nothing to install. As long as you have Java available on your system you will be able to run Brian's code. He has included examples of how to use the programs in this post: http://seqanswers.com/forums/showthread.php?t=41057

[Brian Bushnell]

Actually I have tried brian idea but the problem is nothing is mentioned in site how to install it neither he mentioned it so I am thinking to give try to trimmomatic...

Just unzip and untar the file you download, then you can run the shellscripts.

[paa6]

[QUOTE=Brian Bushnell;136213]Just unzip and untar the file you download, then you can run the shellscripts.[/QUOTE
I did unzip and untar after that I gave code like u said but I am getting this error
singhparul@ubuntu:~/trim_ends$ bbduk.sh in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20
bbduk.sh: command not found

[paa6]

Just unzip and untar the file you download, then you can run the shellscripts.

I HAVE TRIED THIS WAY TOO..... but still getting error
singhparul@ubuntu:~/Desktop$ chmod +x bbduk.sh
singhparul@ubuntu:~/Desktop$ sh ./bbduk.sh
./bbduk.sh: 84: ./bbduk.sh: Bad substitution
./bbduk.sh: 115: ./bbduk.sh: [[: not found
./bbduk.sh: 123: ./bbduk.sh: [[: not found
./bbduk.sh: 132: ./bbduk.sh: Illegal number: unlimited

[Brian Bushnell]

Hmm... you can bypass the shellscript like this:

java -ea -Xmx1g -cp /path/to/current/ jgi.BBDukF in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20

[paa6]

Hmm... you can bypass the shellscript like this:

java -ea -Xmx1g -cp /path/to/current/ jgi.BBDukF in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20

am sorry but again I am getting error
singhparul@ubuntu:~/trim_ends$ java -ea -Xmx1g -cp /path/to/current/ jgi.BBDukF in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20
Error: Could not find or load main class jgi.BBDukF
please tell me step by step...I am newbie in linux

[rajajjcet]

how to install short read alignment and working principle?

hi,how to install short read alignment and working principle?

[GenoMax]

Just unzip and untar the file you download, then you can run the shellscripts.[/QUOTE
I did unzip and untar after that I gave code like u said but I am getting this error
singhparul@ubuntu:~/trim_ends$ bbduk.sh in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20
bbduk.sh: command not found

Parul: Can you try the shell script like below? I am assuming that execute bit has been set on the shell script per one of your previous commands.

Note: You may have to provide full file system paths if the files are not accessible in the current directory.

$ ./bbduk.sh in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20

or if you are not in the directory where the bbduk.sh script is then do the following:

$ /full_path_to/bbduk.sh in=Illumina_raw_reads.fastq out=clean.fastq ktrim=r k=13 literal=AGATCGGAAGAGC minlen=20