adapter dimer sequence structure

[shr19818]

Hi All,

I'm trying to track how the artifact adapter dimer sequence are structured. So far I see dimers of Illumina Paired End PCR primer heavily represented in miseq run reads. So contrary to our assumption of Adaptor1-Adaptor2 ligation, I'm observing adaptor2-adaptor2. I'm baffled of how that can come about biochemically? any views on this appreciated.

dimer sequence I'm observing frequently:

GATCGGAAGAGCGGTTCAGCAGGAATGCCGA-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG