Reads length and display in tview

[VeenaV]

Hi,

I had a couple of questions:

(1) I used the below command to generate the pileup (I created a bowtie index for hg18 & then ran tophat on the sequence data against the UCSC gene annotation "tophat -G hg18.gff3 -i 30 -I 15000 ../bowtie-0.12.5/hg18 s_o_sequence.fastq", the resultant accepted_hits.sam output file was sorted and indexed).
"samtools*pileup*-vcf*hg18.fa*accepted_hits_sorted.bam*>*accepted_hi ts_sorted.pileup"

A couple of lines from accepted_hits_sorted.pileup [The number of reads covering chr1, co-ordinate 747408 (SNP quality score 140) is 28 as per the pileup output]:
chr1 747408 A M 140 140 60 28 ,,c,ccc,,,,,,c,,,,,,,,,,cccc YWPNKONQQOTWSMHPSGQXXXGGHTJO
chr1 748086 A M 22 22 60 11 ......^~,^~,^~c^~c^~, WYYXYXESTEI


Below is a snapshot of what I see when I open tview ("samtools tview accepted_hits_sorted.bam hg18.fa") and navigate to chr1:747408 (the first dotted line appears underlined). I see just 2 reads displayed in the text alignment viewer after I navigate to chr1:747408. Shouldn’t there have been 28 reads?

747411 747421 747431 747441 747451 747461 747471 747481 747491 747501 747511 747521
ACCCTGTCTATACTACCTGCCTGTCTAGCAGATCCACCCTGTCTATACTA CCTGCCCATCCAGCAGGTCCACCCTGTCTACACTACCTCCCTGNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNN
....................................... .............C.........................
.......................................
.......................................
,,,,,,,,,,,,,c,,,,,,,,,,,,,,,,,,,,,,,,,


(2) The read length for the sequence data is 33. However, some of the reads displayed in tview are much shorter. Why would that be?
These are Illumina reads. I used tophat (command used is mentioned above) to generate the accepted_hits.sam from the fastq sequence file. Tophat internally runs the bowtie aligner.
PS: I have other files wherein I ran BWA, but I haven’t tried viewing them yet using tview.

Any suggestions/comments will be helpful.

Thanks in anticipation,
Veena