Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dmacmillan
    Member
    • Jan 2012
    • 49

    Pysam Fetching Incorrect Coordinates

    Hello everyone. I am using pysam to fetch the reads overlapping a given region, however, I am finding that pysam returns a list of reads whose positions do not correspond with the region coordinates that I input. The BAM file is indexed with samtools index 'file.bam'

    For example, I want to fetch this region: chr3:50617849-50618103

    I do so with the following code (inside python command line):
    Code:
    import pysam
    bam = pysam.AlignmentFile('file.bam')
    reads = bam.fetch('chr3',50617849,50618103)
    for read in reads:
        print read.pos
    The first coordinate printed is 50335428, which is outside the scope of my input region completely.

    Does anybody know why this is happening? The BAM file was created from a STAR alignment of paired-end reads against the hg19 human reference genome in case that matters.
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    Right, but does the read stretch into or span that region? You're not asking for reads starting in that interval, you're asking for those that intersect it in any way (including splicing over it).

    Comment

    • dmacmillan
      Member
      • Jan 2012
      • 49

      #3
      Well the distance from that read to the actual start location is ~280,000 nucleotides. I suppose then the read would have to be spliced? Here is one of the reads in question:

      Code:
      ABC-ST978_0126:2:1307:16045:21543#0     403     2       50335428 3
              91M317386N10M   2       50335207        101     GGGGTCTGTAACCACCAGGTCTATAAAACAGCCGACCCAATCTACTTGCTGGCCTTCTGTCTTCCAGTAGTCCTCCTAGTCCACCACTAGGAGGACTAGGA       array('B', [66, 66, 66, 64, 66, 66, 66, 65, 63, 64, 64, 66, 66, 66, 66, 65, 66, 66, 66, 66, 66, 67, 66, 65, 66, 66, 66, 66, 66, 66, 66, 68, 68, 70, 70, 72, 72, 71, 72, 71, 71, 71, 69, 70, 72, 71, 71, 72, 71, 70, 70, 71, 72, 72, 72, 72, 72, 71, 71, 71, 72, 71, 71, 72, 72, 72, 72, 71, 72, 71, 69, 72, 71, 69, 72, 71, 71, 72, 72, 72, 71, 70, 70, 72, 70, 69, 72, 72, 70, 70, 70, 70, 70, 68, 66, 68, 68, 68, 65, 64, 64])    [('NH', 2), ('HI', 2), ('AS', 189), ('nM', 0)]
      I suppose that 317386N region is the gap?

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #4
        Yup, it's a spliced read, which you can tell from the N cigar operator.

        Comment

        • dmacmillan
          Member
          • Jan 2012
          • 49

          #5
          Interesting, glad I know this now. Thanks!

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            No problem, I've been tripped up by this as well. In case you ever use the pileup() functions, keep in mind that this will happen there as well.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM
            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 07-13-2026, 10:26 AM
            0 responses
            24 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-09-2026, 10:04 AM
            0 responses
            33 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-08-2026, 10:08 AM
            0 responses
            21 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            34 views
            0 reactions
            Last Post SEQadmin2  
            Working...