blast fomatdb error

[nufangdeshengming]

I use blast-2.2.17 to perform blast ,but when i type "formatdb -i db.seq -o T -p F",i get nothing new in the result,and there is also no error information,i donnot konw why.
Here is the sequence of db.seq which is in FASTA format:
>fake_seq
AGGAAGAGGAGCTCCTTTCGTTCCAATTCAGGAGAGGAAGTGGTAGGATGCAGCTGCCGATTCATGGATA
CCTCTGGAGTGCATGCAGCAATGCTGTAGGCCTGCACTTGCATGGGTTTGCATGACCCGGCGAGATGAAC
CCACCATTGTCTTCCTCTATTGATTGGATTGAAGGGAGCTCCACATCTCT

[GenoMax]

That looks like an older version of blast (current is 2.3.0). For blast+, the command you should use is makeblastdb. Type makeblastdb -h to get inline help.

[nufangdeshengming]

But i am using blast now

That looks like an older version of blast (current is 2.3.0). For blast+, the command you should use is makeblastdb. Type makeblastdb -h to get inline help.

i know blast+,but i am using blast now ,so how can i solve this problem?

[GenoMax]

Are you able to run

formatdb -h

and get help printed to the screen? Want to check that you are using the correct executable for your OS.

If you are using the -o option then fasta headers need to be formatted in a specific way (see this link for help).