Does any one know how to convert SAM to cufflinks SAM format ?
Even manual is fine I can write a simple code that converts manual to command line.
All I want to know is is the first sequence is really SAM or not (It should be). If it is what coulmn actually represents original SAM format?
Thanx
Even manual is fine I can write a simple code that converts manual to command line.
All I want to know is is the first sequence is really SAM or not (It should be). If it is what coulmn actually represents original SAM format?
Thanx
Code:
IL26_1184:1:109:734:594 67 clone::AL662826.11:1:145431:1 27827 0 36M * 0 80 GGCCGCTGTGCGCGCCCCGCCTGCTGGACCACTTCA >>>>>>><<>>>>>>>>>>>>8<<>8,,<<3<<8<3 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0 IL26_1184:1:109:734:594 147 clone::AL662826.11:1:145431:1 27871 0 36M * 0 -80 CTGCCGGCGTTGCTCAAGCTGGCCTGCGGAGGCGAC 7.6<4667<64<<47<<<<.<<<<2<<<<<<<<<<< MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0
Code:
s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \ CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:-
Comment