First HiSeq 3000 data

[DNATECH]

Hello,

in case you are interested, we have posted some results from our first HiSeq 3000 runs as well as some information and considerations on the changes introduced by the new HiSeq 3000 and Hiseq 4000 sequencer generation. The yields on the first two runs were higher than expected at about 340 million reads per lane. The quality looks good.
There is also link to the complete data from a PhiX lane (including the clusters that did not "pass filter").

http://dnatech.genomecenter.ucdavis....data-download/

Btw, the cluster images do not give away the patterned character of the flowcells. Please see the attachment.

Best,
Lutz

[DNATECH]

Some Q30 plots.

[idedios]

Sweet my company just got one and we'll do our training run in a couple weeks from now. The instrument was setup and configured nearly a month ago so it's bothering to see it idle for so long.

[DNATECH]

We are actually waiting for flow-cells for several weeks; I guess Illumina is surprised that anybody wants to use the new sequencers?

[GenoMax]

@DNATECH: Based on this (and your other post) it sounds like you need "near perfect libraries" to get good data from patterned flowcells. This could be a problem for core facilities, where "variable" quality libraries come in from customers.

It would be interesting to hear about your experiences as real world customer libraries start flowing through.

[pmiguel]

Hello,

in case you are interested, we have posted some results from our first HiSeq 3000 runs as well as some information and considerations on the changes introduced by the new HiSeq 3000 and Hiseq 4000 sequencer generation. The yields on the first two runs were higher than expected at about 340 million reads per lane.

You mean 340 million pass-filter clusters per lane?

--
Phillip

[pmiguel]

What final concentration was the phiX library that you clustered? I mean after neutralization?

I mean is there no danger of overclustering anymore? That was what I was hoping for when I heard about the patterned flowcells...

--
Phillip

[DNATECH]

Yes, an average of 340 million clusters passing filter per lane.

You mean 340 million pass-filter clusters per lane?

--
Phillip

[DNATECH]

Hi Miguel,

the input was 5ul of PhiX at 2 nM. So far we have used 2 nM concentrations for all our libraries/lanes. Illumina recommends up to 3 nM.
From what our FAS told us, I got the impression under-loading could be more detrimental than over-loading.

What final concentration was the phiX library that you clustered? I mean after neutralization?

I mean is there no danger of overclustering anymore? That was what I was hoping for when I heard about the patterned flowcells...

--
Phillip

[DNATECH]

Hi GenoMax,

perhaps we are just being careful at the moment - since Illumina seems to be very careful and there is very little information so far. The customer samples (n=11) have been looking great so far except one; this sample had some larger low complexity component to it (which we were not aware off). For this sample the Q30 rates dropped after the first 60 to 70 bases of low complexity bases from 95% to 70%.

@DNATECH: Based on this (and your other post) it sounds like you need "near perfect libraries" to get good data from patterned flowcells. This could be a problem for core facilities, where "variable" quality libraries come in from customers.

It would be interesting to hear about your experiences as real world customer libraries start flowing through.

[pmiguel]

Hi Miguel,

the input was 5ul of PhiX at 2 nM. So far we have used 2 nM concentrations for all our libraries/lanes. Illumina recommends up to 3 nM.
From what our FAS told us, I got the impression under-loading could be more detrimental than over-loading.

Wow, 2000 pM? I think the highest we ever went on the HiSeq2500 was 23 pM.

--
Phillip

[GenoMax]

To get 2-2.5x more clusters (compared to a 2500) load 100x more? DNA binding in nanowells must not be very efficient.

[DNATECH]

Hi Pmiguel,

the basic procedure looks like:
- 5 ul of library (2 nM to 3 nM including PhiX)
- add 5 ul 0,1 N NaOH
- add 5 ul Tris (200mM)
- add 35 ul Enzyme Master Mix
- load all 50 ul onto cBot

Wow, 2000 pM? I think the highest we ever went on the HiSeq2500 was 23 pM.

--
Phillip

[Brian Bushnell]

I finally finished downloading these, and I'll take a look at the quality from mapping. But before I do that, I always trim adapters... but I was never sure what kind of adapters PhiX reads had. They don't exactly match any adapters in my list, so I'll call them "PhiX adapters". Here they are, for reference:

>Read1_adapter
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA
>Read2_adapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA

Also, at least for the first 4 million reads, 29.36% failed the chastity filter.

[DNATECH]

Hi Brian,

Thanks for looking at the data. The files that I uploaded have 482,680,800 reads. The sequencer generates "reads" for each single nanowell - no matter if it is loaded or not. Thus, the figure of 30% or higher "failing" reads is expected. The SAV viewer indicates a total of 482.68 million nanowells. According to Illumina 60% to 70% of clusters passing filter are considered to be very good; because the figure is calculated with respect to the total number of nanowells. I did intentionally upload files including all non-passing reads (the majority of the "not passing filter" data are likely simply empty nano-wells though).

Lutz

I finally finished downloading these, and I'll take a look at the quality from mapping. But before I do that, I always trim adapters... but I was never sure what kind of adapters PhiX reads had. They don't exactly match any adapters in my list, so I'll call them "PhiX adapters". Here they are, for reference:

>Read1_adapter
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA
>Read2_adapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA

Also, at least for the first 4 million reads, 29.36% failed the chastity filter.